Homozygous viable. Deletion of 621 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCGATATGAAGATCAACTTATTTGTTGG ; Right flanking sequence: TTTGGCCCCGCCCCTCGAATAGCATCGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGGTTACAATAACTCCAAATACATTTATT ; Right flanking sequence: CTTCCCATAGACCTACATTCTGACACCGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2314 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACGTTGCTCTCACAACTTGCATTCCGCAG ; Right flanking sequence: ATTGGTTTTTATAGTTATTAGTATTACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGAGCTTTCTGGCATTTCCTAACCACCG ; Right flanking sequence: CTTGGTGTCTATATCATTGTGAATCTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Y50E8A.3. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok616 homozygotes (slow-growing, viable, fertile, some animals slightly Unc). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 5973 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACAATTGATTCAAGTTAGCTTGAATCCTGT ; Right flanking sequence: GGTGGAATGTCTCCAATACACGACATACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2633 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCCATATGCAGAATGAGCAGCTGTGGGATA ; Right flanking sequence: GGTGCGGATTGAGTTTTCACTGCAATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTCCTGATGGGGCTGTGCATATTATT ; Right flanking sequence: TGAGCTACTACAGAAGAAAAATGATAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTGCATAAAAAACTACAAAATGATGCT ; Right flanking sequence: TTTGGGAAAATAAAACATGCCCAGAACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATACGGTAAGTAATGTCTTATGCCTGCG ; Right flanking sequence: CCAGGTATTGAAATCTACCAAACGCTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Y54E5A.4. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim pharyngeal GFP signal, and segregate dim GFP, brighter GFP (mIs13 homozygotes) and GFP- ok617 homozygotes (slow-growing, mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 4487 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCCGTCTCATCTAAAGTTTGTGTACATA ; Right flanking sequence: CTCGGAGATCACCATCACCACCGCAACAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTATTTTCAACGCTGGCCAACCGCCG ; Right flanking sequence: CTCGTCAACTCATCTTCTACCAAATTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 731 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATCGTCTTCAATCAGATTGATGTCAACA ; Right flanking sequence: CTTGGTTCTGGAATCCAATTTTCTTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2700 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGATTATTTTCATATAGTTGATTCCTGAC ; Right flanking sequence: GCTGGATATAAGCATCGCAGAGACACTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1552 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTTTACAAGTTGTATAAAAGACCGCTC ; Right flanking sequence: ACTTTTCCCCAATGATCAACACACCGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1241 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCGATTTTCCCAAATTTACTGATCCGATG ; Right flanking sequence: TATGGAAGGCACTTCCAAGGACTTCCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2432 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCAATAAAATGTAGCATTAAGTGTAGCCA ; Right flanking sequence: ATGTATGTTTTCCGAATTATTTTTCGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4249 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGAGCTGATTTAATATTTGAATGTAAGG; Right flanking sequence: TTATGGTTCGTAATATTTGTTGTTGTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTATTGTTTCTTTGTTGAATATGGTATG ; Right flanking sequence: TCTTTACCTGCTCTCCATTTTTAGACCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1302 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCACACTGCTCAATGCGTCGCGCTGCTTCT ; Right flanking sequence: ATTTCCCTGGAGCTGAACATATTGTGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F42A6.7. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok592 homozygotes (extremely slow-growing, nearly sterile, often with vulval blip). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 2429 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTGGTTTTAGCTATAAAATTGTCCTCCA ; Right flanking sequence: TGCGGTAGTGACAAGCAAGGGCGATTTCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5552 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGATATTCTGATGTATATGGATCGGATCTA. Right flanking sequence: CTTCATGCCGTCACCAATCATCATCAAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATTCTGGAAATCGGCAAAAAACCAGTT ; Right flanking sequence: GTATAGATAATGCGCTTATTCAAAGTGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5156 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAGTCTGATGAAGATTCTGAGCCACCA. Right flanking sequence: TACCAATGTTCCAGATATTCGTGTCAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4196 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAATCTCAAAAAATCGATGAAATCCATGA ; Right flanking sequence: CGGCGTCGTATCGGTAACCTTTCCAACGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATGATGCAATACATGCTTCTCTTCAGTCG. Right flanking sequence: TTGGGATAATGAAGATAATAGTAACATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F10B5.7. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok629 homozygotes (usually sterile adults, occasionally produce progeny). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 2765 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGAAATTTTAGTTAACATTGGCCAGTT ; Right flanking sequence: CACGGAACCGTGTCACTCCAATATCTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAAAGGCAAATCTGGATATAAACCGCC ; Right flanking sequence: ATCGTATAACCTTGCATTCCACATGTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGACTTGTTACATTGAATTCTGAAGGTAGT ; Right flanking sequence: CACCGGGTCCCAAAAGATCACAAGGTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 438 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ATTAACAACTCAATTAATTCAGTCCTTCCT ; Right flanking sequence: CTGGGAGCGTCATTTGTCGTAGAGAGTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 924 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGAATTGAGAATCTATTCGCGAACGTACT ; Right flanking sequence: TCCAACGAATTCTTGAGACATGGTGATGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 774 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTGAAAACTTGACTTCTGTGGTTTGCAAG ; Right flanking sequence: CGAGTGGGAGAGAGAATAATTTATTTTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 889 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATCCTTCATAACCGAATCCTCGTTCTCCT ; Right flanking sequence: GGGATTTCTGAGCAGTTTGCAGGTGGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

JC8.13. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok627 homozygotes (slow-growing, develop into sterile adults). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1624 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAGCCTAAAACATATTTAAGCCTCCC ; Right flanking sequence: GATCATCCGGAAAGGTCACCAAGTCCGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal deletion balanced by qC1. Deletion of 304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTACATTTTCAAAATTAAAGTATGGCCT ; Right flanking sequence: TGGCGAGAAGAGTGTTGAAGAGGCTGCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2328 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTAAAAAGAAACGCTTTGATTTACCTAGA. Right flanking sequence: GAAGGATTGTGAAACTTTGGAAGGCATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1088 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCGTGGCCGAAAAAAATCCAGAACTTATCG. Right flanking sequence: TTCGGTGGAAAGAAGGTGGAAATTGGCCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7222 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCCTAGAATCGACCGCTTTCAGTGTATT ; Right flanking sequence: TGGGCCCAGTTTTCGGACGGTGGTTTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAAATTTCACAACTAACTAGTAAGGACTC ; Right flanking sequence: TGACTGGAAAGAGCTCTTTTATTTTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2926 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGATCCGATTGCGAACGTTCGATCCCCAAC. Right flanking sequence: CAAAGTCGACGTTGTGCGACAGAACAACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTACCTGCAACCGAACATGCGCTTCCGCCA ; Right flanking sequence: TCCGTTGAGCTGTGAAAATATCAGTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 560 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCAGGATCGCGAGAAAGCGACTTCCGCAT. Right flanking sequence: CGTCGAATGGCCGGAGAGTTGTCATTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.