VC2635 |
C. elegans |
ZK1248.1(ok3390)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1248.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3390 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTCGTCGTTTTTCATC. External right primer: AGTGAATTTCGGTCAATCGG. Internal left primer: GCGCTCAGGATAATAGAACAA. Internal right primer: TTCTGTTTGAATTCCTCGCA. Internal WT amplicon: 1190 bp. Deletion size: 590 bp. Deletion left flank: ATTTTGGTTCCTTACTGTTTGTTAGAGCTT. Deletion right flank: GAAACCAGTAAGTGATAATTTCCTTTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2638 |
C. elegans |
rps-18(ok3353) IV/nT1 [qIs51] (IV;V). Show Description
Y57G11C.16. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3353 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCTTTCGTCTCTCTTCGGA. External right primer: GGCAACACTCATGCTTCTCA. Internal left primer: TGGCTTTTTCCGTTGAAACT. Internal right primer: CTTGGACAGGAAGGTGTTGG. Internal WT amplicon: 1340 bp. Deletion size: 442 bp. Deletion left flank: GCATCTCACTAAATTTTTTATTTTTCAGGG. Deletion right flank: GCCACCCAGTTTAATTATTTTGAGAGTAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2641 |
C. elegans |
oct-1(ok3339) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F52F12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3339 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATATGCCTCGTCCTGGAAC. External right primer: GGCCATGTTCATCAGAAGGT. Internal left primer: TTTCTTTACCACGAAGTAAGCG. Internal right primer: TCTGAATGTTTGAAAGTCGCA. Internal WT amplicon: 1354 bp. Deletion size: 696 bp. Deletion left flank: CATTGAAGTAGAGGCCAAACAACGAAATAT. Deletion right flank: TCTGAATTAAAAATGCTTAATTCAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2642 |
C. elegans |
lam-1(ok3221) IV/nT1 [qIs51] (IV;V). Show Description
W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3221 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 303 bp. Deletion left flank: ATCCCGTTGGATGGGAGAATATTCAAATTA. Deletion right flank: ATCGTTATCAATGTAGACATCTTGCTCTTT. Insertion Sequence: TTGTAGTGAGACCGGAAGCTGAAGGAGATGGATCATGCTCTGATGCTCCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2644 |
C. elegans |
skp-1(gk1091) V/nT1 [qIs51] (IV;V). Show Description
T27F2.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1091 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATAGAGACCCGGATGCAAA. External right primer: AACAGGTCCAGATCCACGAC. Internal left primer: CTCACAAACCGCCATGATTA. Internal right primer: TGAACCAGAACGGACATGAA. Internal WT amplicon: 2496 bp. Deletion size: 1422 bp. Deletion left flank: ACAAGTTAGCACCTGCTCAATATATCAGAT. Deletion right flank: ACAAAACTCTTTGATGATACTGATGTATTT. Insertion Sequence: GGAGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2645 |
C. elegans |
F32D1.2(ok3436) V/nT1 [qIs51] (IV;V). Show Description
F32D1.2. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGAATCCGAAGGTGTCTC. External right primer: GCAGCCCAGTCTGTGTTGTA. Internal left primer: GATCATCGTTATTTTCGCCG. Internal right primer: TATAGAGCCGGGCTGAAATG. Internal WT amplicon: 1263 bp. Deletion size: 791 bp. Deletion left flank: AATGTATCCAAATGGAATTATTCGAATACT. Deletion right flank: CTGGTGGGTCTCGCAACGACATGAAGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2646 |
C. elegans |
lrr-1(ok3435)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2648 |
C. elegans |
sec-8(ok2187) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2660 |
C. elegans |
tax-2(ok3356) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ok3356. Homozygous constitutive dauer deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3356 homozygotes (constitutive dauer, probably non-recovering). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCCAAGAAGTGAAGATTCC. External right primer: ACGCTTGTAATGCCGAAAGT. Internal left primer: GCAAATGCTTCAAAAGAGCC. Internal right primer: GAGTCCGAGCAATTCTGAAAA. Internal WT amplicon: 1122 bp. Deletion size: 367 bp. Deletion left flank: AGGAACATTTCATCCGTATGGTCGTTTCTA. Deletion right flank: TTTGGAGGATTAATCGAGTTTTGAAGGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2662 |
C. elegans |
F57F5.1(ok3370) V/nT1 [qIs51] (IV:V). Show Description
F57F5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3370 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCTAGTAGCGAAATG. External right primer: CAATTTTGGAATTCCTCCGA. Internal left primer: CTCTTCTTGTCGGCCTTGTC. Internal right primer: CCTCAATTCCGCACTCGTTA. Internal WT amplicon: 1101 bp. Deletion size: 337 bp. Deletion left flank: TTACAAGCCATGCCCATCCAACATGTACCC. Deletion right flank: GTTAACGAGTGCGGAATTGAGGGAGGAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2663 |
C. elegans |
lsm-5(ok3431) V/nT1 [qIs51] (IV;V). Show Description
F28F8.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3431 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAATTCCCTCTCACAA. External right primer: TTTCCAGGGACGATCTGAAC. Internal left primer: CTGTTGGGTCTCGGAACTGT. Internal right primer: CAACACGTGCTGAATATGATCC. Internal WT amplicon: 1270 bp. Deletion size: 509 bp. Deletion left flank: TGTACAACGACACTCCGAAATGACGCATAG. Deletion right flank: CATCGGCTCGAAAATCTGGGTGATAATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2664 |
C. elegans |
R05H5.4(ok2875)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R05H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2875 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCACCAACGTAACACCA. External right primer: ACTCTTCTTGGCAGTGCGAT. Internal left primer: ATTCGGATCCACAGACTTCG. Internal right primer: AAGAGAACAAGCAAGACGGC. Internal WT amplicon: 1173 bp. Deletion size: 616 bp. Deletion left flank: ACATTCCAAAGTCAGCCATCTTGACGACTC. Deletion right flank: AGAAGTTTTTCCACCGATCTTCGCCGTCTT. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2666 |
C. elegans |
ceh-6(ok3388) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2670 |
C. elegans |
sos-1(ok3565) V/nT1 [qIs51] (IV;V). Show Description
T28F12.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3565 homozygotes (arrest stage/phenotype undetermined). Any viable non-GFP progeny are not homozygous mutants but rare recombinant heterozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGCAGTCAGGGAAG. External right primer: AAAAGCGTGCTCGACAGAAT. Internal left primer: TCGCGATTTGAAAAGTTGTG. Internal right primer: GACAATCACGAAAAGGAAGAGG. Internal WT amplicon: 1126 bp. Deletion size: 884 bp. Deletion left flank: TCTCATCATGATGTCTCGGTATTTTTTTGT. Deletion right flank: CGTATAAGAATGATATGTCAGTCGTTCAAT. Insertion Sequence: ACAAAACAAAATATGCTTGACTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2680 |
C. elegans |
F54D10.7(ok3404)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54D10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3404 homozygotes (sterile with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCGAGATTTGGAGAAATGA. External right primer: AAGGCGCAGGACAACTACAT. Internal left primer: CAACAACATTCACAATCTTCATCA. Internal right primer: TGTGTGTCCTTTTCCCGTTT. Internal WT amplicon: 1124 bp. Deletion size: 643 bp. Deletion left flank: CTTAATTCCAGCTTCCTCAAGAGTTTGATT. Deletion right flank: TTTCTTTGTTGAAAGCGTCTTGGATCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2682 |
C. elegans |
rpl-18(ok2217) IV/nT1 [qIs51] (IV;V). Show Description
Y45F10D.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2217 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTACAGCGAACTCGGGA. External right primer: TTCCACGTATACGCCAACAA. Internal left primer: GTTGTCCGTGGAGAAGGGTA. Internal right primer: TTTTATGCAGATGGCAACCA. Internal WT amplicon: 2215 bp. Deletion size: 1161 bp. Deletion left flank: TTCTACTAGCCTAAAATTTTTTTCACGTTT. Deletion right flank: GAAGGAAGGAACAATAACGATACACTTATC. Insertion Sequence: CATATATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2699 |
C. elegans |
rpn-1(ok2205) IV/nT1 [qIs51] (IV;V). Show Description
T22D1.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2205 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTGTGTCCGGTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2705 |
C. elegans |
zwl-1(ok2378) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2706 |
C. elegans |
wve-1(ok3308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2709 |
C. elegans |
Y110A7A.8(gk1094) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y110A7A.8. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1094 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk1094/hT2[qIs48] but is gk1094/hT2.) External left primer: TTTCATTCTCTTCGCGACCT. External right primer: CACACTCCAGCACTGGAAAA. Internal left primer: TGCAGCAATGAAGAGAAACG. Internal right primer: TTTCGCATATGGGTCGAAAT. Internal WT amplicon: 2229 bp. Deletion size: 1953 bp. Deletion left flank: AGCGAACTGCAGCAATGAAGAGAAACGAGA. Deletion right flank: ATATATTTATTTGTTACTTTCCTCTTCCTG. Insertion Sequence: GAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2726 |
C. elegans |
pfd-6(ok3600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F21C3.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3600 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 445 bp. Deletion left flank: ATTTTAAAACGTTTAAAGGTAAAATTTATT. Deletion right flank: AAAAGAAGTGAAAGAAAACAAAATTGTGTT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2731 |
C. elegans |
ahcy-1(ok3601) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K02F2.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3601 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGAGGAATACGAATGGTGC. External right primer: CGAAATGAGTGAAGCGTTGA. Internal left primer: CAAGGATGGACAACCACTCA. Internal right primer: CGGGTAGATGGGGAACAATA. Internal WT amplicon: 1126 bp. Deletion size: 715 bp. Deletion left flank: AAAGGGATCTGCTGCTTCCCTCAAGGCTTT. Deletion right flank: AAATTGTATTGCCCTCAAACTTCATATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2733 |
C. elegans |
C08C3.4(ok3550) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C08C3.4. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3550 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTACTTTTATGCCGGCCAAC. External right primer: AGCACTAGAAATGCGCCAGT. Internal left primer: TGTCGACGAGAACTGACATTG. Internal right primer: CTTTTCTTCAATTTCCGCGA. Internal WT amplicon: 1184 bp. Deletion size: 589 bp. Deletion left flank: GCTGTTTGGGTCACATTGAGACATGGCGCA. Deletion right flank: AGTGGTTTCCTCATTGGGCAGAAGGTGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2737 |
C. elegans |
B0495.7(ok3607)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.7. Maternal effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3607 homozygotes (first-generation homozygotes viable and fertile, but F2 arrests as grotty L1 or L2). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACTCAGGATTGATCGCGT. External right primer: TTGGTGTGAATCGTCTCGAA. Internal left primer: ACACATTGGCTGATGGCATA. Internal right primer: CGTCCATCTGGATGTTTTGA. Internal WT amplicon: 1316 bp. Deletion size: 797 bp. Deletion left flank: GCAATGATAAGAAGCATTGTAATTACCATT. Deletion right flank: TCCCTTCTTCGGACCAATTCTCACAACGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2744 |
C. elegans |
acs-1(gk3066) V/nT1 [qIs51] (IV;V). Show Description
F46E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3066 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCGATCAGCAGTTGACCA. External right primer: CAAAGTTGGCAATGGTTGTG. Internal left primer: CAACACAGTTTGCCAGTGCT. Internal right primer: GAGACGACTTGCTGGAGACC. Internal WT amplicon: 2067 bp. Deletion size: 880 bp. Deletion left flank: TTTATTTTAAAAAATATTTAAAAAGTTTTA. Deletion right flank: TATGACTGACATGCAAGTATGCTATGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2762 |
C. elegans |
F28D1.1(ok3338) IV/nT1 [qIs51] (IV:V). Show Description
F28D1.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3338 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCAGCTTGAACGACATGA. External right primer: AACATACTCGTGAATCCGCC. Internal left primer: GAGGAGGATCACTCGCTGAC. Internal right primer: GTCCAATTCCGAGCACATCT. Internal WT amplicon: 1167 bp. Deletion size: 433 bp. Deletion left flank: ACAGCTCGCCTCGAATTTCTTCCCCATCAT. Deletion right flank: CGTGTAAAGAGCCGTATTTGGTGCACAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2763 |
C. elegans |
myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC277 |
C. elegans |
pkc-3(ok544)/mIn1 [dpy-10(e128) mIs14] II. Show Description
F09E5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok544 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2775 |
C. elegans |
cct-2(ok3438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2777 |
C. elegans |
pas-7(ok3447)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK945.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3447 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGTGATGATCGAGGAAGCAG. External right primer: TTCGTCTCTCCCGTAAATCG. Internal left primer: AAGCAGTTGCCGCATAACTT. Internal right primer: AACGGTTCTTCTGATTTCCG. Internal WT amplicon: 1263 bp. Deletion size: 409 bp. Deletion left flank: GAATTGTGCATAAACATGTTTCTGGTTTGT. Deletion right flank: ATTCACATCCAGCTCCTCGATCTTCAGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2785 |
C. elegans |
lsm-4&ada-2(ok3151)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F32A5.7, F32A5.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3151 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTTGGAGGTGCGGACATTAT. External right primer: ATGATCATCCACCAACGACC. Internal left primer: GGAATGTCGTTATTCGATTTTGA. Internal right primer: TTTCGAATTGTCTTTTCGCC. Internal WT amplicon: 1193 bp. Deletion size: 437 bp. Deletion left flank: ACCACCACGACCACGGGATTGCTCGCGCTG. Deletion right flank: AATATTCATCCACGAATCGCAGGCTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2789 |
C. elegans |
C18E3.2(ok3161) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C18E3.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3161 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGGAAGTGCTCCACAAAT. External right primer: AACTCGTGTCGCTTCTGGTT. Internal left primer: CCATTGCCGAAAAAGAAGAA. Internal right primer: CACCTTTTGGAACATGTATCTG. Internal WT amplicon: 1250 bp. Deletion size: 1122 bp. Deletion left flank: AAAGAAGAAGTATGCGGATAAATGTATTCA. Deletion right flank: GAGGAAGGAGTTCAAAGGTATTTGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2791 |
C. elegans |
egl-38(ok3510) IV/nT1 [qIs51] (IV;V). Show Description
C04G2.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3510 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCCCTACCCTACCCTCTG. External right primer: CGACTCCACAGTGCTTTCAG. Internal left primer: GCCCGGTTTTACCCTGTATT. Internal right primer: TTCCGCCTCAAAAGTTTCTC. Internal WT amplicon: 1203 bp. Deletion size: 786 bp. Deletion left flank: AAAATTTTACAAATTAAGCGAATAATACTT. Deletion right flank: GCGATTACAAAATTAATTTGTATTCCTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2792 |
C. elegans |
sar-1(ok3513) IV/nT1 [qIs51] (IV:V). Show Description
ZK180.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3513 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTATGCACAAACGTCGAAGG. External right primer: TTCTCACCCCCATTTAACCA. Internal left primer: ATCCCAAGGATCCCAAAAGA. Internal right primer: AAAATGCCTGATTTACCCGA. Internal WT amplicon: 1167 bp. Deletion size: 425 bp. Deletion left flank: ATTCCTTCTCCGTATCCTTGTCGCTGAAGA. Deletion right flank: TCGTATGTGGTAAACGAAATTCCTCCGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC28 |
C. elegans |
brf-1(gk17)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F45E12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk17 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC280 |
C. elegans |
air-2(ok298)/okIs59 I. Show Description
okIs59 [myo-2::GFP + pes-10::GFP + F22B7.9::GFP] I. B0207.4. Heterozygote has wild-type gross phenotype, with semi-dominant GFP expression in pharynx. Segregates WT dim GFP, WT bright GFP (okIs59 homozygotes) and non-GFP sterile Unc (air-2 homozygotes). Pick dim GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2824 |
C. elegans |
H28O16.1(ok2203) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2825 |
C. elegans |
rpl-30(ok3566) I/hT2g[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2826 |
C. elegans |
C09H10.7(ok2466)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2828 |
C. elegans |
Y79H2A.3(gk1219) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2839 |
C. elegans |
T05H4.11&atp-4(ok2678) V/nT1 [qIs51] (IV;V). Show Description
T05H4.11. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2678 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTTTGAAGCTCGACGTG. External right primer: CGTAATGGCCTCATTCGTTT. Internal left primer: ATTCGAATGGAACCGAGTCA. Internal right primer: TTTCCCGTTTGTAACCTCCA. Internal WT amplicon: 2683 bp. Deletion size: 1414 bp. Deletion left flank: TTGTGTTTCAAATCGGACACTCTGCAAAAT. Deletion right flank: CCTTAGCAGCTTCAAAGTTAGTTGGGAGCT. Insertion Sequence: TCGTTTATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2840 |
C. elegans |
C24D10.4(ok3613) IV/nT1 [qIs51] (IV;V). Show Description
C24D10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3613 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGATGAGAACATCATCCT. External right primer: TCCTATTACATCGCCGTTCC. Internal left primer: AAATCAGAAAATCCGAAGAAAA. Internal right primer: CGACTTCCAGAGGATTGTCC. Internal WT amplicon: 1195 bp. Deletion size: 418 bp. Deletion left flank: TTGTCAATGGAGCGCGCTTACGCAGCTAAA. Deletion right flank: AGTTCCCCGGATTTCCCAGCGAATTTCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2854 |
C. elegans |
H43I07.2(ok3654) V/nT1 [qIs51] (IV;V). Show Description
H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2876 |
C. elegans |
egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2878 |
C. elegans |
F29B9.2(ok3628) IV/nT1 [qIs51] (IV;V). Show Description
F29B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3628 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGCTTATCAAGCACACGA. External right primer: AACCGCGTGAAAGAATATGG. Internal left primer: CATCTCCGGACACCACTACA. Internal right primer: GCTTCTTCATGAGGCGATCT. Internal WT amplicon: 1193 bp. Deletion size: 823 bp. Deletion left flank: ATCAAGGAAGGTCAGACACTGCTCATCCCG. Deletion right flank: ACTATTGTGGATCCCATCTCGAAGCACGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2879 |
C. elegans |
glb-3(ok3630) V/nT1 [qIs51] (IV;V). Show Description
C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2901 |
C. elegans |
F52C12.2&F52C12.6(gk3019) IV/nT1 [qIs51] (IV;V). Show Description
F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC294 |
C. elegans |
sdhb-1(gk165)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F42A8.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- gk165 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2960 |
C. elegans |
C50F2.3(ok3662) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C50F2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3662 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATGGCCGACAAAGAAAATG. External right primer: TTTTTCCAACTTTTCCGTGC. Internal left primer: ATGCCGAACTCTGAGACGAT. Internal right primer: AAAAGTTGGCGAAATTGGTG. Internal WT amplicon: 1186 bp. Deletion size: 656 bp. Deletion left flank: TGGAGAGCACTCTGTGACACTTATGAGAGA. Deletion right flank: CGAGAAGTGTCGATTATGATGCAAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2998 |
C. elegans |
T09E8.1(ok3692) V/nT1 [qIs51] (IV;V). Show Description
T09E8.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3692 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATGGACCGGTCACTAAT. External right primer: GGGGTAGGCAAACATTCTGA. Internal left primer: CGATGCTCGGATTGCTTATC. Internal right primer: CCTCAAGTTGTTCTCAGGTTCA. Internal WT amplicon: 1186 bp. Deletion size: 657 bp. Deletion left flank: AACTTGAACTGACACAAAAAGAACAGAGCT. Deletion right flank: GAATTTGAGAGAATGCGATCAGAGAAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|