maIs137 [let-7p::GFP + unc-119(+)]. Wild type.

maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.

maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.

maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.

maIs162 [mir-59p::GFP + unc-119(+)]. Wild type.

maIs163 [mir-357-358p::GFP + unc-119(+)]. Wild type. [10/01/2018: Received new stock from VT following report from user that GFP expression pattern in original stock was not as expected.]

maIs173 [mir-242p::GFP + unc-119(+)]. Wild type.

maIs177 [mir-243p::GFP + unc-119(+)]. Wild type.

maIs180 [mir-244p::GFP + unc-119(+)]. Wild type.

maIs182 [mir-251p::GFP + unc-119(+)]. Wild type.

maIs184 [mir-51::GFP + unc-119(+)]. Wild type.

maIs185 [mir-2p::GFP + unc-119(+)]. Wild type.

maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.

maIs189 [mir-54-56p::GFP + unc-119(+)]. Wild type.

maIs191 [mir-235p::GFP + unc-119(+)]. Wild type.

maIs196 [mir-227-80p::GFP + unc-119(+)]. Wild type.

maIs197 [mir-234p::GFP + unc-119(+)]. Wild type.

maIs206 [mir-81p::GFP + unc-119(+)]. Wild type.

maIs218 [mir-231p::GFP + unc-119(+)]. Wild type.

maIs220 [mir-360p::GFP + unc-119(+)]. Wild type.

maIs227 [mir-90p::GFP + unc-119(+)]. Wild type.

maIs229 [mir-85p::GFP + unc-119(+)]. Wild type.

maIs234 [mir-53::GFP + unc-119(+)]. Wild type.

maIs236 [mir-246p::GFP + unc-119(+)]. Wild type.

maIs251 [mir-1p::GFP + unc-119(+)]. Wild type.

maIs256 [mir-247-797p::GFP + unc-119(+)]. Wild type.

maIs261 [mir-265p::GFP + unc-119(+)] Wild type.

maIs267 [mir-266p::GFP + unc-119(+)]. Wild type.

maIs268 [mir-259p::GFP + unc-119(+)]. Wild type.

maIs276 [mir-60p::GFP + unc-119(+)]. Wild type.

maIs278 [mir-788p::GFP + unc-119(+)]. Wild type.

maIs300 [mir-82p::GFP + unc-119(+)]. Wild type.

maIs347 [mir-793p::GFP + unc-119(+)]. Wild type.

maIs348 [mir-794p::GFP + unc-119(+)]. Wild type.

maIs352 [mir-71p::GFP + unc-119(+)]. Wild type.

Heterozygotes are superficially WT (DTC migration defects) with relatively dim pharyngeal GFP signal, and segregate superficially WT (DTC migration defects) with dim GFP, Dpy with bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].

maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.

Endogenous nhl-2 locus tagged at the N-terminus with GFP and 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983

maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).

GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.

maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4.