More Fields
Strain Species Genotype Add
CHS1025 C. elegans frpr-10(yum1196) IV; frpr-9(yum1195) V; frpr-7(yum1193) frpr-8(yum1194) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
OP729 C. elegans unc-119(tm4063) III; wgIs729. Show Description
wgIs729 [frpr-9::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PS8398 C. elegans frpr-9(sy1294) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCCATCAGTATTCAATGATATTCAGGCAACCATTC right flanking sequence: GATTATTCGGAGgtattataaaattctgtttattt inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATACCTCCGAATAATCGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616