More Fields
Strain Species Genotype
RG3195 C. elegans frpr-12(ve695[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttagttccagtgagagaaaaatatcatgaa ; Right flanking sequence: TGGTTATACATCAATCAAAAGCATATGAga. sgRNA #1: ataacaacaataaggaATGA; sgRNA #2: ATCAAATCAACGTCTCATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1084 C. elegans frpr-5(yum1507) frpr-6(yum1508) frpr-11(yum1509) frpr-12(yum1510) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS8938 C. elegans frpr-12(sy1581) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTTCCAACTTCTAATGTTCAAAGTTACACCTTGA right flanking sequence: ATGAAGTGTTTTCAATGGTTATGCTACCAATTATT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGAAAACACTTCATTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616