Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS8023 C. elegans syIs503. Show Description
syIs503 [15xUAS::Chrimson::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder (NEB)]. Red light-activated channelrhodopsin cGAL effector. Reference: Cao M, et al. Application of the red-shifted channel rhodopsin Chrimson for the Caenorhabditis elegans cGAL bipartite system. MicroPubl Biol. 2018 Aug 22;2018:10.17912/2JGW-FJ52. doi: 10.17912/2JGW-FJ52. PMID: 32550400.
ZT2 C. elegans drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.