Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes mostly fertile at or below 20C; all sterile at 25C. Progeny are fertile heterozygotes with variable Gon abnormality, e1254 homozygotes (strong Gon, "white patch" phenotype) and eDf18 homozygotes (embryonic lethal). See also WBPaper00003841.

Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]

Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.

WT PHENOTYPE

Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.

C40A11.7, C40A11.8, C40A11.1, F56E10.1, Y38C9A.1, C50C10.2, F21H7.9. The allele gk1184 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 2042 bp. Deletion left flank: ACCGCAATTAATTCCAATTCTAAGGTTTAT. Deletion right flank: ACTGGCGTCTTACAGTAAATTTTGTGTGAC. The allele gkDf17 was identified by CGH but not confirmed by PCR. Left flanking probe: ATTCCGCGATGTCTCCTTAAATCTTTTGGCAGAGGTTCTCGATTATCCAT. Right flanking probe: ATTGATCGAAAGTTACGAAGACGTGGACTAGTCCCAAAATTCCTAGTGAC. Left deleted probe: GAAAATAGATTTCTACCACTGAACTGTTTTTCTTAACAAACTCATCGAAT. Right deleted probe: CTGTTGAGAACATATCTAGTATTAAGGAAGGAGGGAACTATTCCACAGGC. The allele gkDf18 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAATTTTCGAGGAAGATGAAGTTTATGCGGACGTCCAAAGTGTTGAAAA. Right flanking probe: GATTTCGCTGTGATAAGCGTCGAGGAGGCAATCGAAATGTGGAGCTTCTG. Left deleted probe: CCAAAGTGTTGAAAAACGGAAAATTCAGGATTTCGACGAGCGAATTGAGG. Right deleted probe: CAATTATGCAAATCTCGTCGATATTATACAAAATGATATAGATTTCGCTG. The allele gk3035 was identified by CGH but not confirmed by PCR. Left flanking probe: TGTTTCAGTATTGCCGTCTTATTATGTATAGATTTGCTATTCCATTTCTA. Right flanking probe: CATTTTCGAGTTCAATTTTCTGTGCAAACGCTGGAATGACAATATTCATG. Left deleted probe: TTTATCGTCCCATTAGCATTGTCACTTTTCAATGTTACTACAGTAGGATT. Right deleted probe: TTGTACGAAGGAGAGGAATATGCAAAGTTGAATGCTATTATTCATCTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

sEx10008 [rCesF18E2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14224 [rCesF18A1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14650 [rCes F18C5.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

muEx261[ceh-20::GFP at C terminus + odr-1::RFP].

Daf-c at 25.5C; grow at 20C or less. Long lived.

muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain.

muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.

Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.

Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C.

muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva.

Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).

rtEx224 [F18E9.2::GFP + lin-15(+)]. Maintain by picking non-Muv. Maintain at 20C.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F18A11.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGTAGTAATCTCAGCGAACGAGTTCTGCTGAATGT. Right flanking sequence: TGGCGGCAAAAAGTTCGAGACTACGGTCGCCACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGAGTTCTGCTGAATGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

F18H3.3. Homozygous. Outer Left Sequence: TTTGTTCTGAGCTTGGGCTT. Outer Right Sequence: AATTTTCATGCCCATTCCAA. Inner Left Sequence: GGCCGAACAAATTACCATGT. Inner Right Sequence: AAATGTGGGCGAAAGATGAG. Inner Primer PCR Length: 3336 bp. Deletion Size: 1835 bp. Deletion left flank: AGATTTTTAAATTTTTTTGGGGTTTTTTGT. Deletion right flank: CCTTTGCTGTTTCCTTCATCGTCGGTGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A1.6. Homozygous. Outer Left Sequence: GTCGAGACCGAACACCGTAT. Outer Right Sequence: CCACATACGATGCGCTTAAA. Inner Left Sequence: GGCAATATTTTGTGCCTGGT. Inner Right Sequence: TGCCGCTGTTAAAAGACTGA. Inner Primer PCR Length: 1259 bp. Deletion Size: 486 bp. Deletion left flank: GTCATCATTCCAAATGCATCTTCATACTTT. Deletion right flank: GTACTTGTTGTAGCAGATTCAGTCATATAT. Insertion Sequence: CAATCATCCATTGTCAATGTTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A12.6 Homozygous. Outer Left Sequence: catccggcaacaaacctact. Outer Right Sequence: gttcaacttttccgtcgcat. Inner Left Sequence: gcgaagttctgggcaattta. Inner Right Sequence: tggtttccagtgcttttcag. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1089 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acatatttgtgtcgggtgattatttacaat ; Right flanking sequence: aggtcatataaggaaaagaacagctaggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F18C12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18E2.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok830 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok932 homozygotes (early- to mid-larval arrest). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A1.2 Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok939 homozygotes (probable embryonic arrest). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18E9.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18E9.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A12. External left primer: TAGTCGGCGCTTCAGGTACT. External right primer: CTGGGCTCTTTACTTCCGTG. Internal left primer: TTTCATGGCTTCTATCCGCT. Internal right primer: TTATCTGGAATCGGCTTTGG. Internal WT amplicon: 1859 bp. Deletion size: 721 bp. Deletion left flank: AATAAGGAAACATACCCGAAAAACTCGAGG. Deletion right flank: AAAAAATGGGGTTTTAATATTGTTTTTATA. Insertion Sequence: AAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hda-1(cw2) mutants are viable as homozygotes, although many die as embryos or larvae. Severely uncoordinated with defective vulval development and reduced fertility. Reference: Zinovyeva AY, et al. Dev Biol. 2006 Jan 1;289(1):229-42. PMID: 16313898

cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background.