armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.

armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.

Heterozygotes are Dpy and segregate Dpy, Sterile Dpys and dead eggs. [CGC received new stock in 1/1999 from Leon Avery.]

Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]

Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf17 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

WT PHENOTYPE

The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males.

WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.

C40A11.7, C40A11.8, C40A11.1, F56E10.1, Y38C9A.1, C50C10.2, F21H7.9. The allele gk1184 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 2042 bp. Deletion left flank: ACCGCAATTAATTCCAATTCTAAGGTTTAT. Deletion right flank: ACTGGCGTCTTACAGTAAATTTTGTGTGAC. The allele gkDf17 was identified by CGH but not confirmed by PCR. Left flanking probe: ATTCCGCGATGTCTCCTTAAATCTTTTGGCAGAGGTTCTCGATTATCCAT. Right flanking probe: ATTGATCGAAAGTTACGAAGACGTGGACTAGTCCCAAAATTCCTAGTGAC. Left deleted probe: GAAAATAGATTTCTACCACTGAACTGTTTTTCTTAACAAACTCATCGAAT. Right deleted probe: CTGTTGAGAACATATCTAGTATTAAGGAAGGAGGGAACTATTCCACAGGC. The allele gkDf18 was identified by CGH but not confirmed by PCR. Left flanking probe: CGAATTTTCGAGGAAGATGAAGTTTATGCGGACGTCCAAAGTGTTGAAAA. Right flanking probe: GATTTCGCTGTGATAAGCGTCGAGGAGGCAATCGAAATGTGGAGCTTCTG. Left deleted probe: CCAAAGTGTTGAAAAACGGAAAATTCAGGATTTCGACGAGCGAATTGAGG. Right deleted probe: CAATTATGCAAATCTCGTCGATATTATACAAAATGATATAGATTTCGCTG. The allele gk3035 was identified by CGH but not confirmed by PCR. Left flanking probe: TGTTTCAGTATTGCCGTCTTATTATGTATAGATTTGCTATTCCATTTCTA. Right flanking probe: CATTTTCGAGTTCAATTTTCTGTGCAAACGCTGGAATGACAATATTCATG. Left deleted probe: TTTATCGTCCCATTAGCATTGTCACTTTTCAATGTTACTACAGTAGGATT. Right deleted probe: TTGTACGAAGGAGAGGAATATGCAAAGTTGAATGCTATTATTCATCTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

sEx12531 [rCes F17C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12533 [rCes F17C8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12533 [rCes F17C8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12531 [rCes F17C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14448 [rCesF17C11.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx374 [F17C8 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul F17C8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.

muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.

muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.

Isolated in Fort Collins, CO. Species identification done by Lynn Carta.

350 bp deletion in F17E5.2

F17A2.8. Homozygous. Outer Left Sequence: gtggacgactaccaatggct. Outer Right Sequence: tcagacatgggcgaatacaa. Inner Left Sequence: cttgatcagtcgctctcgtg. Inner Right Sequence: cgcaaccattttggagagac. Inner Primer PCR Length: 2335. Deletion Size: 2064. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C8.4. Homozygous. Outer Left Sequence: CTTCTCACATCAAACGGCAA. Outer Right Sequence: ACACCACTCATGCAAAGCTG. Inner Left Sequence: CCATGGATGCCTGAAAAGTT. Inner Right Sequence: CAGAAACGTTCGCAATTCAA. Inner primer WT PCR product: 2592. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17A2.5. Homozygous. Outer Left Sequence: AACAGTTGATGTTCCTCCCG. Outer Right Sequence: ACAATGGGCGAATAATCCA. Inner Left Sequence: GGGCCATCTGAAAATGAGAA. Inner Right Sequence: CCCACCTCTCGCTAATGTGT. Inner primer WT PCR product: 2509. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 4865 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcactctgtccgcgtttctttgaccgcat ; Right flanking sequence: tagcctcgtaatgtagcagatacccaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10915 [F17C11.1::H1-wCherry + unc-119(+)].

F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17A2.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1071 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACACTTTTTACAGGAAAATTTCTTGTCGA; Right flanking sequence: GGAGCTCTTGCGGCAAGCAATTTAGGATTT. See WormBase Variation gk5023 for details.

Homozygous viable. Deletion of 763 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTCTGAAAAATCAAAACAAAACCGTCTCCT. Right flanking sequence: TGGAGACACGAACCAGTGAATCGTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F17C11.8. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk427 homozygotes (slow-growing, often sterile, mildly Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAAGATTTTGCATTGATTTTTAGATAGT; Right flanking sequence: TGCAACCATTTTAAGATTGTTTATTTGAAA. sgRNA #1: AAAGTACACGTATGCCACCT; sgRNA #2: CCATACCATCAGGAGGCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.