More Fields
Strain Species Genotype
VC1229 C. elegans K08F11.3(ok1715) IV/nT1 [qIs51] (IV;V). Show Description
K08F11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1715 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCATGGACGTTGTTGTGC. External right primer: GCATTTCTCCTTTTTGCTCG. Internal left primer: TTTGCTTCAGATTTGCGATG. Internal right primer: TTTCAGATGGCTGACACTCG. Internal WT amplicon: 3347 bp. Deletion size: 773 bp. Deletion left flank: GCAGCCTGATCAACTCTCTGATCAACAAGA. Deletion right flank: GTTTCCACATGATATATTCAATTTTTTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1997 C. elegans F40F11.2(ok2621) IV/nT1 [qIs51] (IV;V). Show Description
F40F11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2621 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCTGCACAGCCTTCTCAA. External right primer: GAGCAGGTCTACCCTTCACG. Internal left primer: AGATAATGCCACCACAGGCT. Internal right primer: TGTTGAAGCAGGTGGAATTG. Internal WT amplicon: 3165 bp. Deletion size: 2394 bp. Deletion left flank: AGGAATCAATGCAATATGGTCACCAACAGA. Deletion right flank: AAGTTGCATGTTAAGATAAAAGCTTCACCA. Insertion Sequence: CATATAATAAGTACAATACATACAATATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2004 C. elegans +/szT1 [lon-2(e678)] I; C03F11.3(ok2598)/szT1 X. Show Description
C03F11.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2598 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGACAAGGCAATGAGACC. External right primer: TGGGAGCTTTAATCGAAGGA. Internal left primer: GCCAAGTCCAACAGCTATCC. Internal right primer: CAATTGCTCTTTTCGGGCTA. Internal WT amplicon: 1231 bp. Deletion size: 302 bp. Deletion left flank: GTAAATCCCCATTGCAAACAAAAAAAGTGT. Deletion right flank: CAGTACGTTTTATTAGCGTAGGGCCACCTA. Insertion Sequence: ACCAACGCCGAGTTCGGGTCCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2037 C. elegans C46F11.3(gk1070) III. Show Description
C46F11.3. External left primer: AGCAAAAGAATTGGCGAAGA. External right primer: CGATACCTCCAGATCCTCCA. Internal left primer: TATCACCAGGTGTGCATTGG. Internal right primer: AACTCCTTGACGCCAGACAT. Internal WT amplicon: 1888 bp. Deletion size: 971 bp. Deletion left flank: AAATCAGGCGTTGATCCCATAGGACTAAAA. Deletion right flank: TTTTAAACTCTTCGCGCGCTGAAAAAGGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2153 C. elegans T235F11.1(ok2186) III. Show Description
T23F11.1. External left primer: GAGACCCACTCGCTAACCAC. External right primer: GCGGGATGAACAATAGAGGA. Internal left primer: CTTCTGTCTCTCGGAAACGC. Internal right primer: CGAAAGGTATTTCAACCGGA. Internal WT amplicon: 3253 bp. Deletion size: 1421 bp. Deletion left flank: GAAAGTTATCAGAGCAAAAATGTGATAAAA. Deletion right flank: CTGACAAGCTGACACCGGATCACGAGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2224 C. elegans F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2450 C. elegans gcy-17(gk1155) I. Show Description
W03F11.2. External left primer: TCTAGGTCAAAAGCGGAGGA. External right primer: CTTTAACACGGTGAAGGGGA. Internal left primer: GGAAATGGAGCATCGAGGTA. Internal right primer: CATATGCAAGATGTTTGCCG. Internal WT amplicon: 1241 bp. Deletion size: 655 bp. Deletion left flank: GCATTGAGCTTCTGCTAATGACATCGGCCA. Deletion right flank: TAAATTTTGAGAGTAAAGTTCTTACATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2627 C. elegans F54F11.2(ok3251) III. Show Description
F54F11.2. External left primer: AGTGGTACTGTAGGCCGGTG. External right primer: TCGGAGATCATAGGGCATTC. Internal left primer: TCCTACGCCTGTGGAAACTT. Internal right primer: TTGCATAGGCCTTCTGCTTT. Internal WT amplicon: 1216 bp. Deletion size: 472 bp. Deletion left flank: AGGATCCAACTTACCAGACCACTATCAATA. Deletion right flank: CTATGAGCAGAACATTGCAGTCAAGTACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2654 C. elegans ubl-5(ok3389) I. Show Description
F46F11.4. External left primer: GGAGCGAAGAAAGAGGGAGT. External right primer: GTGCATGCGCCTTTAAGTTT. Internal left primer: GCAGAAATTAATGGGGTGGA. Internal right primer: GCGTCGAGTTGTGTGTTTTT. Internal WT amplicon: 1248 bp. Deletion size: 294 bp. Deletion left flank: TTTTTTTTTATTAAACAATAAAAAATGTAT. Deletion right flank: TCAAATTTTCAATTTGTTTCTAATATATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3368 C. elegans ubl-5(gk3358) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F46F11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3358 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCCTCCGAAGAGAGCTTAT. External right primer: TCGCTGCCTAAACTTTTCGT. Internal left primer: ATTGCCCTTGGTCTGAAATG. Internal right primer: GTGCATGCGCCTTTAAGTTT. Internal WT amplicon: 1544 bp. Deletion size: 487 bp. Deletion left flank: GTTATTAATGTTTTTTCTCATGTAAAATAT. Deletion right flank: GTGATTTCAATCATTTTTCCTGAAAGGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC413 C. elegans tns-1(ok581) I. Show Description
F46F11.3. Superficially wild type, perhaps slightly small. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4178 C. elegans W03G9.2(gk5265) I; C34F11.1(gk5266) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.
VC4413 C. elegans R02F11.3(gk5491[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2082 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAAAAATTCCAGCAATTCAACCGTAC. Right flanking sequence: AGCCGGTGCTATTGTGGTTTCTATGTACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
BC10062 C. elegans dpy-5(e907) I; sEx890. Show Description
sEx890 [rCesF11F1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10095 C. elegans dpy-5(e907) I; sEx10095. Show Description
sEx10095 [rCesF11C3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10719 C. elegans dpy-5(e907) I; sIs10576. Show Description
sIs10576 contains [rCes F11D5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11048 C. elegans dpy-5(e907) I; sEx11048. Show Description
sEx11048 [rCes F11A10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12190 C. elegans dpy-5(e907) I; sEx12190. Show Description
sEx12190 [rCesF11C3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12883 C. elegans dpy-5(e907) I; sEx12883. Show Description
sEx12883 [rCes F11E6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12884 C. elegans dpy-5(e907) I; sEx12884. Show Description
sEx12884 [rCes F11E6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13072 C. elegans dpy-5(e907) I; sEx13072. Show Description
sEx13072[rCesVF11C1L.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13193 C. elegans dpy-5(e907) I; sEx13193. Show Description
sEx13193 [rCes F11C1.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14579 C. elegans dpy-5(e907) I; sIs13193. Show Description
sIs13193 [rCes F11C1.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14631 C. elegans dpy-5(e907) I; sEx14631. Show Description
sEx14631 [rCes F11A10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14710 C. elegans dpy-5(e907) I; sEx14710. Show Description
sEx14710 [rCes F11H8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15760 C. elegans dpy-5(e907) I; sEx15760. Show Description
sEx15760 [rCesF11G11.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15870 C. elegans dpy-5(e907) I; sEx15870. Show Description
sEx15870 [rCesF11A5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15871 C. elegans dpy-5(e907) I; sEx15871. Show Description
sEx15871[rCesF11A5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC2738 C. elegans sDf110 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36s and dead eggs.
BC4787 C. elegans sEx111. Show Description
sEx111 [F11H8 (III) + pCes1943[rol-6(su1006)]]. segrgnt 4. 20 ng/ul F11H8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
BC5243 C. elegans sEx340. Show Description
sEx340 [F11D12 (III) + pCes1943[rol-6(su1006)]]. 10 ng/ul F11D12 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
CER529 C. elegans sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CF1135 C. elegans egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1137 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs61. Show Description
muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.
CF1139 C. elegans daf-16(mu86) I; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.
CF1170 C. elegans egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1192 C. elegans egl-27(n170) II; muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)].
COP1626 C. elegans ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
DWF1105 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger.
DWF1106 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.
DWF1107 Acrobeloides butschlii Show Description
Original sample from peach orchard at Lodi CA. Original culture sent to DWF from B. Jaffee. Identification by E. Mae Noffsinger.
DWF1108 Acrobeloides sp. Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.
DWF1109 Acrobeloides thornei Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]
DWF1110 Acrobeloides ellesmerensis Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.
ENL67 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.
EU626 C. elegans rfl-1(or198) III. Show Description
Temperature sensitive maternal effect lethal mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.
LY110 C. elegans B0399.1(nf110) V. Show Description
Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.
OH2724 C. elegans otIs133; otEx1545. Show Description
otIs133 [pttx-3::RFP + unc-4(+)]. otEx1545 [F11H8.2::GFP + rol-6(su1006)]. Maintain by picking GFP+ Rollers. RFP expressed in AIY only. Reference: Wenick AS, Hobert O. Wenick AS, Hobert O. Developmental Cell. 2004 Jun;6(6):757-70.
OS1585 C. elegans nsEx864. Show Description
nsEx864 [F11C7.2p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Specific expression of GFP in AMsh. Reference: Bacaj T, et al. Science. 2008 Oct 31;322(5902):744-7.
PS9928 C. elegans F11E6.6(sy1981) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F11E6.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATATTTTTTTGTTTCTCTTCTTAAGAAATATCCTCAT. Right flanking sequence: ATTCTACCGTTTCTTGCGTCCCGTGATGCATCAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCAAGAAACGGTAGAATATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.