More Fields
Strain Species Genotype
RB1011 C. elegans crb-1(ok931) X. Show Description
F11C7.4 Homozygous. Outer Left Sequence: TGAATCTTTGCAATTCGTGG. Outer Right Sequence: CTTGGTGTTCAACATGACCG. Inner Left Sequence: ATTGGCAAACGATTTTCTCG. Inner Right Sequence: CAGTCAACGGACAGCTTGAA. Inner Primer WT PCR Product: 3232. Deletion size: 843 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1379 C. elegans F11C7.1(ok1564) X. Show Description
F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1544 C. elegans F11A5.4(ok1857) V. Show Description
F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2088 C. elegans F11E6.8(ok2754) IV. Show Description
F11E6.8 Homozygous. Outer Left Sequence: gaatgcatctgagcagcaaa. Outer Right Sequence: gccaggcaagaacagaaaag. Inner Left Sequence: ttagtgaaaagacggcctgg. Inner Right Sequence: tgcggtcaaaacactgaaag. Inner Primer PCR Length: 1244. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2176 C. elegans gly-4(ok2943) V. Show Description
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2288 C. elegans gst-8(ok3111) II. Show Description
F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]
RB2452 C. elegans F11A3.1(ok3391) V. Show Description
F11A3.1 Homozygous. Outer Left Sequence: tgatccaaattgggactgct. Outer Right Sequence: ggattttgtggaaagcaagc. Inner Left Sequence: gaaagctctcttgtttcttcca. Inner Right Sequence: tttgtcaaactgtgccgatt. Inner Primer PCR Length: 1276. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2584 C. elegans F11A6.2(ok3596) I. Show Description
F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2597 C. elegans F11A6.2(ok3619) I. Show Description
F11A6.2 Homozygous. Outer Left Sequence: actaacaaatggggcagcac. Outer Right Sequence: gcgagctttgaacttttgct. Inner Left Sequence: caaaaatgttgctcccatca. Inner Right Sequence: ttttctttcagttcagcccc. Inner Primer PCR Length: 1196. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB788 C. elegans F11D5.3(ok574) X. Show Description
F11D5.3. Homozygous. Outer Left Sequence: GTTCAAAAAGAGCGCAAAGG. Outer Right Sequence: CAACCAATTCGGGAAAGAAA. Inner Left Sequence: TTTTCCTCGGCTACTGTGCT. Inner Right Sequence: GGACAATTTGAGCGGAGATG. Inner primer WT PCR product: 3007. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3101 C. elegans F11A10.5(ve601[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2313 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tggcacgtcaccaacaaccaccaaccggct ; Right flanking sequence: ttgtactcttccttccaaacttcgtgttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3108 C. elegans F11G11.5(ve608[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acgttttcagatttctagaaATGACCGGTC ; Right flanking sequence: tcctaccaagtagacatattaactgttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW11911 C. elegans unc-119(tm4063) III; stIs11911. Show Description
stIs11911 [F11A1.3a::H1-wCherry + unc-119(+)].
SD1388 C. elegans unc-119(ed3) III; gaIs217. Show Description
gaIs217 [F11E6.3p::HIS-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
SP1540 C. elegans mnDf111/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and UncVul.
SWF117 C elegans flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
VC1335 C. elegans F11A5.4(ok1841) V/nT1 [qIs51] (IV;V). Show Description
F11A5.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1841 homozygotes (probable embryonic/early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTATGGAAGCGACTGTTG. External right primer: TGCTTGCTTCATTTTTCACG. Internal left primer: TTATCCCTTTTCCCCATTCC. Internal right primer: ATACCTGCCATTGGACTTCG. Internal WT amplicon: 2332 bp. Deletion size: 997 bp. Deletion left flank: TTTTTTTGAATATTTGGGTCAAATTCCTAA. Deletion right flank: AACTGGATTTCAGTTGTATTTGCGCACGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1895 C. elegans +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III. Show Description
F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2204 C. elegans unc-122(ok2882) I. Show Description
F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2297 C. elegans unc-122(ok3029) I. Show Description
F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 741 bp. Deletion left flank: AAGATACTATCATTCCAGTGAGTATAAAAC. Deletion right flank: TTTGTTCGCGGAATTTTGAGGCTGGAAACT. Insertion Sequence: TATTTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC230 C. elegans vap-1(ok392) X. Show Description
F11C7.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2365 C. elegans F11E6.8(gk1178) IV. Show Description
This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC243 C. elegans daf-12(ok493) X. Show Description
F11A1.3, F11A1.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2982 C. elegans gkDf24 I; ikke-1(gk1264) III. Show Description
F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3135 C. elegans F11E6.1(gk3287) IV. Show Description
F11E6.1. External left primer: AAAAACGTTCTAAGGCTAAATTGCT. External right primer: AAATTCAGCACAATAGAGAATCCTG. Internal left primer: CGGTTTTAATGGCTCCAAAA. Internal right primer: CTTGAGCAGTTCGGTTGACA. Internal WT amplicon: 2099 bp. Deletion size: 464 bp. Deletion left flank: TTTTAAAAGATTTTTCGAAGCCTATTCATC. Deletion right flank: ATTCATCATGGCCCATTAATGGGTGACTGG. Validation: gk3287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3714 C. elegans F11A5.3(gk3668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 370 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTGTGTGTATGTATGTAGATCAGTGTTCC; Right flanking sequence: CGGAAAGTCTAATCTATTGCTGCGATTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3802 C. elegans F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.
VC469 C. elegans +/szT1 [lon-2(e678)] I; nhr-25(ok645)/szT1 X. Show Description
F11C1.6. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok645 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC48 C. elegans kpc-1(gk8) I. Show Description
F11A6.1a. Slow-growing, slightly small and slightly Unc in the head region. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC782 C. elegans cpsf-4&mig-32(ok844) IV/nT1 [qIs51] (IV;V). Show Description
F11A10.3, F11A10.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok844 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. cpsf-4 was formerly known as tag-287. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC786 C. elegans +/szT1 [lon-2(e678)] I; ppk-3(ok1150)/szT1 X. Show Description
VF11C1L.1. Homozygous sterile deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, ok1150 hemizygotes (WT males) and ok1150 homozygotes (usually sterile, sometimes Dpyish, may produce a few progeny). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WF1131 C. elegans cam-1(gm105) II. Show Description
cam-1 hypomorph. Grows best at 15C.
WJA1190 C. elegans rps-20(srf1190[rps-20::3xFLAG]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
XF110 C. elegans polk-1(lf29) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.