sEx11072[rCesC46F11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11664 [rCes C08F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12117 [rCesF46F11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12246 [rCes F54F11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12371 [rCes F40F11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12076 [rCesC34F11.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12409 [rCes T23F11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12371[rCesF40F11.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14228 [rCes F35F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14231 [rCesF29F11.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14602 [rCes K08F11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14994 [rCesR04F11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15496 [rCesC34F11.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15498 [rCesC34F11.3b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx411 [T23F11 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul T23F11 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

sEx680 [F40F11 (IV) + pCes1943[rol-6(su1006)]]. 20 ng/ul F40F11 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).

The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.

raEx66 [F46F11.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx230 [R04F11.5::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.

Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]

Heterozygotes are Ces and segregate Ces, UncVul and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

wgIs109 [blmp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of blmp-1 coding sequence of fosmid ID#WRM0622cF11 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs709 [T23F11.4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. GFP expression in developing vulval cells, VCs and uterine pi lineage cells. Received new stock 9/2003. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Received new strain from Bhagwati Gupta on April 7, 2008.

syIs103[unc-119(+) + pPGF11.13(lin-11::GFP)]. GFP fluoresence is observed in the vulva, uterine pi cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs53 [pPGF11.07(lin-11::GFP) + unc-119(+)] V. GFP expression in developing vulval cells and VC neurons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23F11.2. Homozygous. Outer Left Sequence: cacctttctgtaggcgcttc. Outer Right Sequence: ccgtgtgtggttctcctttt. Inner Left Sequence: tcaagaaacccgaccaagtc. Inner Right Sequence: tcctagatggatggacggac. Inner Primer PCR Length: 2160. Deletion Size: 1356. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56F11.2. Homozygous. Outer Left Sequence: CCGCCAAATCCTTATTTTCA. Outer Right Sequence: TTTTTCTGAATTTTTCGGCG. Inner Left Sequence: TGGAATCCAACAAAACACCA. Inner Right Sequence: TGAACGTGTCTGGGATGAAA. Inner Primer PCR Length: 2864 bp. Deletion Size: 1924 bp. Deletion left flank: GCAGCTGAAGAGCTCTACCGTGTATTTGAA. Deletion right flank: TGCTGACAAAGATGAAGATTTGGCTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08F11.14. Homozygous. Outer Left Sequence: CCATCTTCAAGCTTTGCCTC. Outer Right Sequence: CACATTCGTCACCTGAATGC. Inner Left Sequence: CCAAAGTTGAGCACGTGAGA. Inner Right Sequence: GTTGCAAGGACTGATGCAGA. Inner primer WT PCR product: 3374. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.3. Homozygous. Outer Left Sequence: CAAAGTCGCGAACAATTGAA. Outer Right Sequence: CGCTTGAGTGGGCTTTACTC. Inner Left Sequence: TGGCAAATTGCTTTGGGTAT. Inner Right Sequence: CAAGAAGACCATGATCGCAA. Inner primer WT PCR product: 3355. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F11.2. Homozygous. Outer Left Sequence: GAGGAAGCTCTCGAGCAGAA. Outer Right Sequence: GCAGACGCTATTGACGCATA. Inner Left Sequence: ACAGCGAAGAGAAGATGCGT. Inner Right Sequence: GGCTGAAACGTTCCTTTTTG. Inner Primer WT PCR Product: 2816. Deletion size: 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

stIs11952 [F29F11.5a::H1-wCherry + unc-119(+)].

gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaEx227 [C08F11.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational C08F11.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

WT PHENOTYPE

Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs.

C14F11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1715 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCATGGACGTTGTTGTGC. External right primer: GCATTTCTCCTTTTTGCTCG. Internal left primer: TTTGCTTCAGATTTGCGATG. Internal right primer: TTTCAGATGGCTGACACTCG. Internal WT amplicon: 3347 bp. Deletion size: 773 bp. Deletion left flank: GCAGCCTGATCAACTCTCTGATCAACAAGA. Deletion right flank: GTTTCCACATGATATATTCAATTTTTTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807