BC10204 |
C. elegans |
dpy-5(e907) I; sEx10204. Show Description
sEx10204 [rCes C32F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10614 |
C. elegans |
dpy-5(e907) I; sEx10614. Show Description
sEx10614 [rCes T25F10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10711 |
C. elegans |
dpy-5(e907) I; sIs10218. Show Description
sIs10218 [rCes C13F10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10848 |
C. elegans |
dpy-5(e907) I; sIs10703. Show Description
sIs10703[rCesR09F10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10910 |
C. elegans |
dpy-5(e907) I; sEx10910. Show Description
sEx10910 [rCesT20F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC11111 |
C. elegans |
dpy-5(e907) I; sEx11111. Show Description
sEx11111[rCesC32F10.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC11751 |
C. elegans |
dpy-5(e907) I; sEx11751. Show Description
sEx11751[rCesF53F10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC11763 |
C. elegans |
dpy-5(e907) I; sEx11763. Show Description
sEx11763 [rCesK04F10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12482 |
C. elegans |
dpy-5(e907) I; sEx12482. Show Description
sEx12482 [rCes C18F10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12677 |
C. elegans |
dpy-5(e907) I; sIs11111. Show Description
sIs11111[rCesC32F10.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC12844 |
C. elegans |
dpy-5(e907) I; sIs12662. Show Description
sIs12662 [rCes F53F10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC13073 |
C. elegans |
dpy-5(e907) I; sIs12930. Show Description
sIs12930 [rCes F56F10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC14025 |
C. elegans |
dpy-5(e907) I; sEx14025. Show Description
sEx14025 [rCesT07F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC14442 |
C. elegans |
dpy-5(e907) I; sEx14442. Show Description
sEx14442[rCesK04F10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC15500 |
C. elegans |
dpy-5(e907) I; sEx15500. Show Description
sEx15500 [rCes C18F10.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC15755 |
C. elegans |
dpy-5(e907) I; sEx15755. Show Description
sEx15755 [rCesC32F10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC15932 |
C. elegans |
dpy-5(e907) I; sEx15932. Show Description
sEx15932[rCesF53F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC442 |
C. elegans |
sDf10/unc-31(e169) IV. Show Description
Heterozygotes twitch in 1% nicotine. Hets are slow, and are somewhat difficult to distinguish from unc-31 homozygotes. Df/Df homozygotes die as early larvae. Maintain by picking twitchers in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC5612 |
C. elegans |
sEx642. Show Description
sEx642 [F19F10 (V) + pCes1943[rol-6(su1006)]]. 20 ng/ul F19F10 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
CB2776 |
C. elegans |
eDf10/eDf24 I. Show Description
Hets are WT and segregate WT, dead eggs, and larval lethals (eDf24 homozygotes). eDf24 = let(e2000).
|
|
CB5348 |
C. elegans |
mrt-2(e2663) III. Show Description
Unable to propagate indefinitely: lines become sterile from F10-F28, with short telomeres and fused chromosomes. Hypersensitive to X-irradiation; weak Him phenotype; strong Him phenotype in later generations resulting from X-A fusions. Cross once or twice, freeze down many F2 mrt-2 plates, and go back to these plates every two months for fresh a mrt-2 line. A BstN1 RFLP makes the mrt-2 mutation easy to track.
|
|
DA1046 |
C. elegans |
hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f). Show Description
Animals carrying sDp2 are Unc and segregate Unc and dead eggs.
|
|
DA496 |
C. elegans |
sDf10 unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
|
|
DM3010 |
C. elegans |
unc-112(r367) V; raDf10/+ X. Show Description
The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.
|
|
DM7334 |
C. elegans |
pha-1(e2123) III; raEx334. Show Description
raEx334 [F53F10.1::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DR918 |
C. elegans |
mDf10/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, early larval lethals and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
EM128 |
C. elegans |
mab-21(bx53) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Slightly shorter than WT. mab-21(bx53)/yDf10 is embryonically lethal with embryo arrest at 2 fold stage.
|
|
FF10 |
C. elegans |
dpy-6(f10) X. Show Description
Dpy. Semi-sterile. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]
|
|
FX30218 |
C. elegans |
tmC30 [ubc-17(tmIs1247)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30229 |
C. elegans |
tmC30 X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30236 |
C. elegans |
tmC30 [ubc-17(tmIs1243)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
GE2204 |
C. elegans |
unc-32(e189) tDf10/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs, and males. tDf10 is embryonic lethal.
|
|
JK1547 |
C. elegans |
ces-1(n703) qDf10/unc-13(e1091) lin-11(n566) I. Show Description
Heterozgotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
KR1557 |
C. elegans |
hDf10 dpy-5(e61) unc-29(e403)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Wild-type to mildly long phenotype, sometimes a bit Unc. Segregates wild-type, Dpy-18 (hT2[dpy-18 bli-4] homozygotes), hDf10 dpy-5 unc-29 homozygotes (probably dead eggs) and large numbers of aneuploids (dead eggs). dpy-18(h662) completely suppresses bli-4(e937), is only very mildly Dpy, and has a distinctive dark body and large clear vulval region as a young adult, before becoming gravid. Do not passage: hT2 homozygotes seem somewhat healthier than the het, and will overgrow the plate. Pick longish wild-types and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
KR2288 |
C. elegans |
unc-11(e47) I; hEx10. Show Description
hEx10 [C12H4 + M01A12 + C07F10 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 57% Unc Rollers. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
KR2361 |
C. elegans |
unc-11(e47) I; hEx15. Show Description
hEx15 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 39% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
KR2362 |
C. elegans |
unc-11(e47) I; hEx26. Show Description
hEx26 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 53% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
KR2409 |
C. elegans |
unc-11(e47) I; hEx30. Show Description
hEx30 [C12H4 + M01A12 + C07F10 + rol-6(su1006)]. Line 2. Maintain by picking UncRollers. Segregates Uncs and UncRollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
MT26375 |
C. elegans |
lin-15B&lin-15A(n765) X; nEx3045. Show Description
nEx3045 [C32F10.8p::GCaMP3::unc-54 3' UTR + lin-15(+)]. Pick non-Muv animals to maintain array. Line is quite stable, ~80% transmission. Expression of GCaMP3 in pm3, mc1, and in other pharyngeal cells posterior to pm3. Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
|
|
NG2618 |
C. elegans |
yDf10 unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. Derived from strain TY1353. Grows fairly slowly but seems more stable than TY1353, which gives lots of steriles.
|
|
OH7155 |
C. elegans |
otIs181 III; F19F10.1(tm456) V. Show Description
otIs181 [dat-1::mCherry + ttx-3::mCherry]. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
|
|
OP486 |
C. elegans |
unc-119(tm4063) III; wgIs486. Show Description
wgIs486 [F19F10.5::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
PS10022 |
C. elegans |
F56F10.1(sy2040) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F56F10.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cttttttgaattctagTCACCATTTGGACCGGTT. Right flanking sequence: AACAGCGTCTGATGGGGCAAGCATTCAAGAGACTTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCCCATCAGACGCTGTTAAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS7778 |
C. elegans |
clik-1(sy1084) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6)
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG;
right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;
inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Reference: Wang H, et al. G3 (Bethesda).
|
|
PS9858 |
C. elegans |
C18F10.7(sy1941) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18F10.7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGGATTCGCCAGCGAAACTCGAATTCCCTCTA. Right flanking sequence: CACTGGGCAGTGTACGTCGACTGCAAGGATGAGCTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTCGAATTCCCTCTACAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
RB1086 |
C. elegans |
inx-5(ok1053) X. Show Description
R09F10.4 Homozygous. Outer Left Sequence: TTGCAAGCATTATTTGCGAG. Outer Right Sequence: ATTCCATTTTCCCATCCTCC. Inner Left Sequence: GGCAGCTTGACACAATTGAA. Inner Right Sequence: TTATTGCCGGTGGTTCTGAT. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1232 |
C. elegans |
K04F10.1(ok1291) I. Show Description
K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1406 |
C. elegans |
npp-11(ok1599) I. Show Description
F53F10.5 Homozygous. Outer Left Sequence: ttttaggccatcattttcgc. Outer Right Sequence: cgacgagttgttcgttttca. Inner Left Sequence: ctgctaccacaacagcctca. Inner Right Sequence: tgtggtcatccttcagcttg. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1413 |
C. elegans |
Y51F10.2(ok1610) I. Show Description
Y51F10.2. Homozygous. Outer Left Sequence: CTTCAGAGCCGTAGGTCAGG. Outer Right Sequence: ACGTTGCACCATGTTCAAAA. Inner Left Sequence: AAAACTGGCGGTATTGATGC. Inner Right Sequence: TTCTGATCCTCCCCCTTCTT. Inner Primer PCR Length: 2508 bp. Deletion Size: 1161 bp. Deletion left flank: CAATTTGCACAAAGTGCAACGCGATTTTCG. Deletion right flank: AATTTTGAGTATAAAATATAATTATCTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1649 |
C. elegans |
tbck-1(ok2038) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1334 bp. Deletion left flank: CAATAAATACTACACAGATGATCAGGAGAA. Deletion right flank: TTGTCACGGAATCTCAACATTTTGTCTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|