Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

C02F12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14F11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B9.8a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33F10.5. Superficially wild type. External left primer: GAGCCGTTTTAACCCAATCA. External right primer: TAATTTTCAGAACCGTCGGG. Internal left primer: ACGTTCTGCTGCTCTCCATT. Internal right primer: GCAACCAACTCCTTCCATTC. Internal WT amplicon: 3304 bp. Deletion size: 1554 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52F12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk563 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGAACTTGGCTGTTGGA. External right primer: CGCAGATGTATGGTTTGGTG. Internal left primer: TTGAAACATCCATGAAGCCA. Internal right primer: CACTGATGAACAGCAAACGG. Internal WT amplicon: 2042 bp. Deletion size: 632 bp. Deletion left flank: AAGAATATTTGATTGCTGCTGGCCTGAAAA. Deletion right flank: AGACCAACGGGACACAGACAGATTTCCGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B9.1, F15B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok313 homozygotes (mid- to late larval arrest, may develop to adulthood and lay eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19H6.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk506 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAAAAGAATCGGCCTAGC. External right primer: CACGCAAACGAGAACACAGT. Internal left primer: GGGCTAAGGCTCTCGCTAAT. Internal right primer: CAAATGCATCCAGTAGGCAA. Internal WT amplicon: 1675 bp. Deletion size: 340 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1715 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCATGGACGTTGTTGTGC. External right primer: GCATTTCTCCTTTTTGCTCG. Internal left primer: TTTGCTTCAGATTTGCGATG. Internal right primer: TTTCAGATGGCTGACACTCG. Internal WT amplicon: 3347 bp. Deletion size: 773 bp. Deletion left flank: GCAGCCTGATCAACTCTCTGATCAACAAGA. Deletion right flank: GTTTCCACATGATATATTCAATTTTTTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54F10AL.2. Superficially wild type. External left primer: TAGCTAGCCCATGTGCCTTT. External right primer: TTTTGCGATGTGAATCGTGT. Internal left primer: TTTTAGCCACACCATCCACA. Internal right primer: CCAAAAACATGGGAAAATCG. Internal WT amplicon: 3113 bp. Deletion size: 920 bp. Deletion left flank: CAATTAAAAATTTTTTTTCTTGATTTTCTA. Deletion right flank: AAAATTGTGTCTAGGGGTGAAAAATTGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A5.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1841 homozygotes (probable embryonic/early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTATGGAAGCGACTGTTG. External right primer: TGCTTGCTTCATTTTTCACG. Internal left primer: TTATCCCTTTTCCCCATTCC. Internal right primer: ATACCTGCCATTGGACTTCG. Internal WT amplicon: 2332 bp. Deletion size: 997 bp. Deletion left flank: TTTTTTTGAATATTTGGGTCAAATTCCTAA. Deletion right flank: AACTGGATTTCAGTTGTATTTGCGCACGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13E6.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1828 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGAGGAGTGGGATCAATG. External right primer: GCGTTTCACGGATACTTGTG. Internal left primer: CTTTGAAATTTCCCCTGCAA. Internal right primer: AATAACGCCACCTGCAAAAG. Internal WT amplicon: 2983 bp. Deletion size: 1090 bp. Deletion left flank: GATCATCAAGCATTTTTTTGATATCATGTA. Deletion right flank: ATTGTGTAATTTTCAGCATCTTCTTGTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.10. Superficially wild type. External left primer: GGCACCGTTGTTTTAGATGC. External right primer: GAATGCAGATTTTTGCACGA. Internal left primer: CCCGTTTTGAGCAATCAAGT. Internal right primer: CTCTGCGTGTCAAAAATCCA. Internal WT amplicon: 3024 bp. Deletion size: 2220 bp. Deletion left flank: TTGAAAGTGTGGTGGGTGGGCGGAGATTCC. Deletion right flank: AAAGCTTTTCACGATGAGATGCTCGAACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15H10.3, F15H10.4. Superficially wild type, with small broods of viable progeny and lots of unfertilized oocytes. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 349 bp. Deletion left flank: TTTGCCGCTGCACACATGTATGTTTGAAAA. Deletion right flank: AAAATCCTCTGATCGGTTTCGTCTAGCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13D12.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1875 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGATGTGGGGGTTTTAGGA. External right primer: ATCGCGTCGCTCACTAGAAT. Internal left primer: ATCGGGGAGAGAAAGAGAGC. Internal right primer: GGGGCACTATTGCATCATCT. Internal WT amplicon: 2980 bp. Deletion size: 1978 bp. Deletion left flank: GTAGAATACGATCGGGGAGAGAAAGAGAGC. Deletion right flank: ACGAGACACCCGCACGTTTCCCTCGCGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B4.12. Superficially wild type. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1010 bp. Deletion left flank: TCACAAATCACCTCATCGTAAAACATTTCA. Deletion right flank: CGAGTGCTAAAAGCGGGCTCCGCGCAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 2143 bp. Deletion left flank: GGAATGTTGCCTGAGCAATTTCCTTCTTTT. Deletion right flank: GCTAGAATTGTAGGCAATTGTCGATTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1203 bp. Deletion left flank: AAATATTCCTGCAATCTTATATTTTTCACA. Deletion right flank: GCGTTTTGAATAGACGTTAGACAGCGTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13C5.2. External left primer: GCAAAATCTTTGTTGGGGAA. External right primer: TCGCCGATCAACTTCTTTCT. Internal left primer: CATTCTGCCATTTCCTTCGT. Internal right primer: CGTCAACTGGCTTACGGAAT. Internal WT amplicon: 1651 bp. Deletion size: 385 bp. Deletion left flank: CTCTGTTCTCTCAGCGGTGGCCAGTGTGTA. Deletion right flank: ATTACTCAGAACTATAAAAACAACATTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F4.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2067 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGGCAGGTGAAACAGTTC. External right primer: GATGGGAGCAGATTTTCAGC. Internal left primer: ATCTCATTGCCGATTGGAAC. Internal right primer: GTCCAGTCGTCCCAGTTGTT. Internal WT amplicon: 3301 bp. Deletion size: 1167 bp. Deletion left flank: CATAAAAATAGCACCACTGTTGCAGTCCAA. Deletion right flank: ACTCGTCTTCATTTCCAAAAATTCAGTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 1704 bp. Deletion left flank: AATACCTCTACTAAAAATTTTTCATCACTG. Deletion right flank: AAAAATACATTTACTTAACATTCAGTTGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2135 homozygotes (sterile, oftein with abnormal vulva). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCATGGACTTGAGGATTGG. External right primer: AATGGTGCCATCTATCAGGC. Internal left primer: TGAGCATCATTGGGAACAAA. Internal right primer: ATAACTCAAAAAGCGCCGAA. Internal WT amplicon: 3344 bp. Deletion size: 1311 bp. Deletion left flank: TTGTATCTGTAATAAAATCGAAAAAGTAAT. Deletion right flank: GAGCATTACAGAATGAGAAGTTTGAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10G7.3. External left primer: TTCGAAATCGATTGAAACCC. External right primer: GCTCGAGAGGCTGCTTTAGA. Internal left primer: TCCGTTCGAAATTTCCTGTT. Internal right primer: CCCCGTGTCTTTCATTGATT. Internal WT amplicon: 2106 bp. Deletion size: 1708 bp. Deletion left flank: TGGAAAAATAAATAAATAAATACGAAGAAG. Deletion right flank: AGTAAAGAAATTGATTTAAAAAGAAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 668 bp. Deletion left flank: AGGAAGAGGACGGCCGGGAGGTGGATTGCA. Deletion right flank: ACGCTAAAATTGTCTGGAAAACTGCCAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 960 bp. Deletion left flank: AAAAAATATTCCATTCGAAAGTAATTCGTA. Deletion right flank: ACTCTGAAAAATACATTTACTTAACATTCA. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3041) in F13A2.8, detectable by PCR using the following primers. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1081 bp. Deletion left flank: AGCCAGGTTTGCTCAAGGTAAAAAATGCCT. Deletion right flank: TTTTACTCCTTTTTCTACAGTCGTTGTTAT. Validation: gk3041 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk840) in F41G4.1, detectable by PCR using the following primers. External left primer: TCGTTCTTTCGTAAAACCCG. External right primer: TTCTGGCTTAAGCTGCCAAT. Internal left primer: GAAGGCAAATTGCTCAGCTC. Internal right primer: TTCAATGTGATCGTCTTCGC. Internal WT amplicon: 1889 bp. Deletion size: 925 bp. Deletion left flank: TGCAGTGTAGAGTCGGGTCAAAAAGACAAG. Deletion right flank: AAGATCAACTACACCAGTCCAATTTTCAAT. Insertion Sequence: ATCAACAAA. Validation: No CGH probes for gk840. Other deletions (gk3131, gk3132, gk3133) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2252 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGCCACTTCAGGGAAAG. External right primer: AGACAAGGCTGGTCCTGCTA. Internal left primer: GGCAAACAACAAGGCAATTT. Internal right primer: GATCACGCCAAAGCAAATCT. Internal WT amplicon: 3379 bp. Deletion size: 1510 bp. Deletion left flank: TAGGGTGTTCGTTTTTCGATTTTTTTTTTA. Deletion right flank: ATTTCATTCAGAAGTCCGGGATTAAGTGGA. Insertion Sequence: TTATGCCATTTGAAAGAGCATTTTTTAAATGTTTTTCGATTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13A2.8, Y47D7A.3. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1042 bp. Deletion left flank: AGTCGATTTATTCCTGACCCAAGTGGTATA. Deletion right flank: GCATCCCTTGTTCCATCTCCAAAATTGTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54F10AM.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGGCGACTTTTCAC. External right primer: AGGGGGAACTGTCGGTTAGT. Internal left primer: TACAAATCCCCGTCCCAATA. Internal right primer: AGAAGTCGAGGTGGCAGGTA. Internal WT amplicon: 3304 bp. Deletion size: 2261 bp. Deletion left flank: GCGATAATTTGTTGTTTTTACTGAAAATTT. Deletion right flank: TCGAGGGTGGCTACTGTATTCTCGCGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10A3.12. External left primer: AAAAATGCTCCAAAGCATGG. External right primer: GATTTTTACGGAAAACGCCA. Internal left primer: CCCAAGCTTTTCAACTTTCG. Internal right primer: TGGGAACTTTTCCTGATTGC. Internal WT amplicon: 2833 bp. Deletion size: 1054 bp. Deletion left flank: GCATGTAAAAGCTATGGTTTGGTCCAACAG. Deletion right flank: GTTTTTCTGCTTCTACTACTTAAATGGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32F10.8. External left primer: GCATTCCGCATTCTCCCATG. External right primer: GCATGCGAACCGTACAAGCA. Internal left primer: CCCATGTATCCTTTGGATAC. Internal right primer: TTCCGGACTCGTCACAAGTC. Internal WT amplicon: 1307 bp. Deletion size: 594 bp. Deletion left flank: TAACTGCTTAGGAAAAAAAGCTCACTTATT. Deletion right flank: CATGGAATTCCTCCATCACGTCTCTTAATA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2621 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCTGCACAGCCTTCTCAA. External right primer: GAGCAGGTCTACCCTTCACG. Internal left primer: AGATAATGCCACCACAGGCT. Internal right primer: TGTTGAAGCAGGTGGAATTG. Internal WT amplicon: 3165 bp. Deletion size: 2394 bp. Deletion left flank: AGGAATCAATGCAATATGGTCACCAACAGA. Deletion right flank: AAGTTGCATGTTAAGATAAAAGCTTCACCA. Insertion Sequence: CATATAATAAGTACAATACATACAATATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537