More Fields
Strain Species Genotype
RB862 C. elegans zig-2(ok696) X. Show Description
F42F12.2. Homozygous. Outer Left Sequence: TTTGTTTCGGGTAAAGCCAC. Outer Right Sequence: TTGCGCCCTCTAGAAACACT. Inner Left Sequence: TTTGTCTTGCCCCACCTAAC. Inner Right Sequence: AGCAAAGCAAAGGGCAACTA. Inner primer WT PCR product: 2229. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB889 C. elegans ceh-40(ok740) X. Show Description
F17A2.5. Homozygous. Outer Left Sequence: AACAGTTGATGTTCCTCCCG. Outer Right Sequence: ACAATGGGCGAATAATCCA. Inner Left Sequence: GGGCCATCTGAAAATGAGAA. Inner Right Sequence: CCCACCTCTCGCTAATGTGT. Inner primer WT PCR product: 2509. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB915 C. elegans ksr-1(ok786) X. Show Description
F13B9.5. Homozygous. Outer Left Sequence: AGGGAAAAGATCCGGAGAAG. Outer Right Sequence: TTGACACTTGCGAGAATTGC. Inner Left Sequence: TCACGTGCGGGATACAGTAA. Inner Right Sequence: TTAAACTTCGGACTTGGCGT. Inner Primer WT PCR Product: 3347. Deletion size: 2088 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB932 C. elegans F19B6.4(ok806) IV. Show Description
F19B6.4 Homozygous. Outer Left Sequence: GTGCCTCATTAAGCAATCGG. Outer Right Sequence: ATCATTTGGCGCAGAAAATC. Inner Left Sequence: CCCCACTCAAAAGTCACGAT. Inner Right Sequence: GGCCACAGTTCGATCTCATT. Inner Primer PCR Length: 3307. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB976 C. elegans rhgf-1(ok880) X. Show Description
F13E6.6. Homozygous. Outer Left Sequence: TTACTTTGGCCACACCATCA. Outer Right Sequence: GCATTCAAGTCAAAGGGCAT. Inner Left Sequence: CGTAGTTTGCGCACTCACAT. Inner Right Sequence: TGTAGGGATGCTATCTGGGG. Inner Primer WT PCR product: 3285. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB981 C. elegans F19F10.5(ok888) V. Show Description
F19F10.5. Homozygous. Outer Left Sequence: ACACCAGTTGCAATTCTCCC. Outer Right Sequence: AGTTTGGGTGAGAACCAACG. Inner Left Sequence: TTTCGCAGAATTTCGAGGAT. Inner Right Sequence: CTGTCGGCAAGAAGAAAAGG. Inner Primer WT PCR product: 2581. Deletion size: 2158 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB988 C. elegans cey-2(ok902) I. Show Description
F46F11.2. Homozygous. Outer Left Sequence: GAGGAAGCTCTCGAGCAGAA. Outer Right Sequence: GCAGACGCTATTGACGCATA. Inner Left Sequence: ACAGCGAAGAGAAGATGCGT. Inner Right Sequence: GGCTGAAACGTTCCTTTTTG. Inner Primer WT PCR Product: 2816. Deletion size: 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3039 C. elegans spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3094 C. elegans +/mT1[umnIs52] II; F10E9.5(ve594[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny.  Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3095 C. elegans F17H10.1(ve595[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4865 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcactctgtccgcgtttctttgaccgcat ; Right flanking sequence: tagcctcgtaatgtagcagatacccaaaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3096 C. elegans F18A1.7(ve596[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1089 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acatatttgtgtcgggtgattatttacaat ; Right flanking sequence: aggtcatataaggaaaagaacagctaggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3101 C. elegans F11A10.5(ve601[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2313 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tggcacgtcaccaacaaccaccaaccggct ; Right flanking sequence: ttgtactcttccttccaaacttcgtgttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3108 C. elegans F11G11.5(ve608[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acgttttcagatttctagaaATGACCGGTC ; Right flanking sequence: tcctaccaagtagacatattaactgttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3167 C. elegans Y54F10AM.5(ve667[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous larval arrest. Deletion of 1461 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve667 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aacttgtgtggatttacgggcaaacagccg ; Right flanking sequence: ACAATATTACTGAAAGCTAGatttctctga. sgRNA #1: ataaaatttgttttgcgcaa; sgRNA #2: AGCGCCAGTCGTTGTATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3175 C. elegans Y45F10B.13(ve675[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 11717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaagtgtttgttttttgttagtttctaag ; Right flanking sequence: gatccccttcttcttcttcttttcgttgta. sgRNA #1: gcttttaagtgaatacCGGT; sgRNA #2: agaagaagaaggggatccta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3188 C. elegans Y45F10D.7(ve688[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 6878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve688 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RG3205 C. elegans F19C7.2(ve705[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2784 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattaataggactttccaaaaaattgttga ; Right flanking sequence: AGgtgagtttttgcgtcttgataaaaaatc. sgRNA #1: actgaaatcaaattggtctt; sgRNA #2: GCACAGGCTATTAGGACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3208 C. elegans F19C7.4(ve708[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2275 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtgttaaacggctataaaaaattcgtcca ; Right flanking sequence: aggttcatttaagaatgcctcttattcaaa. sgRNA #1: acaactatgggacaacgtag; sgRNA #2: CTATTAGGCAGCATTCAGgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3252 C. elegans F10D2.10(ve752[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1587 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACCCGTCCCTTCCGCATCAAAAATCTTTTT ; Right flanking sequence: gccgaatgaacagaccacttttttagaatg. sgRNA #1: CACAACCTCTGCCACCAAAT; sgRNA #2: cattctatcgtttactctcA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3263 C. elegans F15D3.6(ve763[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3268 C. elegans +/mT1 [umnIs52] II; F10E9.11(ve768[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve768 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tTCATTTCTTCTCCTTTTTCTCCTTATCCA ; Right flanking sequence: aaaatataatttatgccagtaatgagtatc. sgRNA #1: CGAGAGGATACAGAAAAGAG; sgRNA #2: cgaaattcatgtcacgagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3269 C. elegans F10G8.9(ve769[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3273 C. elegans F13H10.3(ve773[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACATAAACTAATCCAGAAATTGATCCCA ; Right flanking sequence: AGGACATTTTTTCACTGCAAATCGCCGAAT. sgRNA #1: CAACTTAACTTCCAGATATG; sgRNA #2: TACACCAATAGCTCCATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3373 C. elegans F14H3.12(ve873[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:ATGAACTCCATTCAAATACAAGCGTGGTAG ; Right flanking sequence:CCTGATCAGCAGTCTCCAGCGCAAACCCAA. F14H3.12 sgRNA #1:TGTGCAGACCTGAAAGAACT ; F14H3.12 sgRNA #2:AAGATCAGGCGCGAGCAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3382 C. elegans F15A4.10(ve882[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAAATACATTTTTTGGCAGAAAGAAAATG ; Right flanking sequence: TGGAAATGGAGGGGTTTGGCTGAAAATTGA. F15A4.10 sgRNA A: AAATTGATATGGATTTGTGG; F15A4.10 sgRNA B: GGACATTTTGCAAGTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5005 C. elegans F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5455 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4374 and CGC48. gk5455 is a 2246 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW10710 C. elegans unc-119(ed3) III; zuIs178; stIs10642. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10642 [F23F12.9::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10899 C. elegans unc-119(ed3) III; zuIs178; stIs10813. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10813 [F16B12.6::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW11141 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10915. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10915 [F17C11.1::H1-wCherry + unc-119(+)].
RW11495 C. elegans unc-119(tm4063) III; stIs11495. Show Description
stIs11495 [daf19a::H1-wCherry + unc-119(+)].
RW11582 C. elegans unc-119(tm4063) III; stIs11582. Show Description
stIs11582 [F13D11.1::H1-wCherry + unc-119(+)].
RW11620 C. elegans unc-119(tm4063) III; stIs11620. Show Description
stIs11620 [F19F10.1::H1-wCherry + unc-119(+)].
RW11777 C. elegans unc-119(tm4063) III; stIs11777. Show Description
stIs11777 [F13D11.2a::H1-wCherry + unc-119(+)].
RW11803 C. elegans unc-119(tm4063) III; stIs11803. Show Description
stIs11803 [F36F12.8::H1-wCherry + unc-119(+)].
RW11911 C. elegans unc-119(tm4063) III; stIs11911. Show Description
stIs11911 [F11A1.3a::H1-wCherry + unc-119(+)].
RW11952 C. elegans unc-119(tm4063) III; stIs11952. Show Description
stIs11952 [F29F11.5a::H1-wCherry + unc-119(+)].
RW12347 C. elegans F19F10.1(st12347[F19F10.1::TY1::EGFP::3xFLAG]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
SAL150 C. elegans pha-1(e2123) III; denEx28. Show Description
denEx28 [F10A3.4::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
SD1388 C. elegans unc-119(ed3) III; gaIs217. Show Description
gaIs217 [F11E6.3p::HIS-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
SD1968 C. elegans unc-119(ed3) III; gaEx224. Show Description
gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SD1973 C. elegans unc-119(ed3) III; gaEx225. Show Description
gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SD1983 C. elegans unc-119(ed3) III; gaEx227. Show Description
gaEx227 [C08F11.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational C08F11.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SP1540 C. elegans mnDf111/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and UncVul.
SP271 C. elegans mnDp1(X;V)/+ V; mnDf10 X. Show Description
WT PHENOTYPE
SP272 C. elegans mnDp1(X;V)/+ V; mnDf11 X. Show Description
WT PHENOTYPE
SP273 C. elegans mnDp1(X;V)/+ V; mnDf13 X. Show Description
WT phenotype. Should throw dead eggs.
SP274 C. elegans mnDp1(X;V)/+ V; mnDf15 X. Show Description
WT PHENOTYPE
SP275 C. elegans mnDp1(X;V)/+ V; mnDf17 X. Show Description
WT PHENOTYPE
SP276 C. elegans mnDp1(X;V)/+ V; mnDf18 X. Show Description
WT PHENOTYPE
SP277 C. elegans mnDp1(X;V)/+ V; mnDf19 X. Show Description
WT PHENOTYPE.