Homozygous viable. Deletion of 3011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATACATAAACTAATCCAGAAATTGATCCCA ; Right flanking sequence: AGGACATTTTTTCACTGCAAATCGCCGAAT. sgRNA #1: CAACTTAACTTCCAGATATG; sgRNA #2: TACACCAATAGCTCCATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5455 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4374 and CGC48. gk5455 is a 2246 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10642 [F23F12.9::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10813 [F16B12.6::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10915 [F17C11.1::H1-wCherry + unc-119(+)].

stIs11495 [daf19a::H1-wCherry + unc-119(+)].

stIs11582 [F13D11.1::H1-wCherry + unc-119(+)].

stIs11620 [F19F10.1::H1-wCherry + unc-119(+)].

stIs11777 [F13D11.2a::H1-wCherry + unc-119(+)].

stIs11803 [F36F12.8::H1-wCherry + unc-119(+)].

stIs11911 [F11A1.3a::H1-wCherry + unc-119(+)].

stIs11952 [F29F11.5a::H1-wCherry + unc-119(+)].

denEx28 [F10A3.4::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

gaIs217 [F11E6.3p::HIS-24::mCherry + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).

gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaEx227 [C08F11.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational C08F11.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

Heterozygotes are WT and segregate WT, dead eggs and UncVul.

WT PHENOTYPE

WT PHENOTYPE

WT phenotype. Should throw dead eggs.

WT PHENOTYPE

WT PHENOTYPE

WT PHENOTYPE

WT PHENOTYPE.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs (some early larval lethals). Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as L1s. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and Unc-4 lethals that arrest at L2. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.

Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. [12/93 **mnC1 appears to have broken down**]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of F19F10.9 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs.

Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.

Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.

Heterozygotes are WT hermphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; yDf13 unc-1 dpy-3), WT males and Dpy males.

The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males.

WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.

yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.

Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.

F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537