More Fields
Strain Species Genotype
RB1627 C. elegans pll-1(ok2003) III. Show Description
K10F12.3. Homozygous. Outer Left Sequence: AAAACACCAATCAGGTTCGC. Outer Right Sequence: TGACCGGATAGAATTCGGAG. Inner Left Sequence: CACATGGCAAATTTAGGGCT. Inner Right Sequence: TTCAAGCAGACCATCTGCAC. Inner Primer PCR Length: 3277 bp. Deletion Size: 1120 bp. Deletion left flank: CAATCTCATGACAGTCGACGGCTTCACATC. Deletion right flank: TACCAATATATGTAATAAAGGACGATAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1649 C. elegans tbck-1(ok2038) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1334 bp. Deletion left flank: CAATAAATACTACACAGATGATCAGGAGAA. Deletion right flank: TTGTCACGGAATCTCAACATTTTGTCTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1650 C. elegans F56F11.2(ok2039) III. Show Description
F56F11.2. Homozygous. Outer Left Sequence: CCGCCAAATCCTTATTTTCA. Outer Right Sequence: TTTTTCTGAATTTTTCGGCG. Inner Left Sequence: TGGAATCCAACAAAACACCA. Inner Right Sequence: TGAACGTGTCTGGGATGAAA. Inner Primer PCR Length: 2864 bp. Deletion Size: 1924 bp. Deletion left flank: GCAGCTGAAGAGCTCTACCGTGTATTTGAA. Deletion right flank: TGCTGACAAAGATGAAGATTTGGCTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1657 C. elegans R04F11.1(ok2047) V. Show Description
R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1666 C. elegans tbck-1(ok2064) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1935 bp. Deletion left flank: TGAAAACGGTGGAAGAAATGCGTGCAGCCG. Deletion right flank: GAAATGCATTCCCATTAATGATTGCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1687 C. elegans F13B6.1(ok2097) IV. Show Description
F13B6.1. Homozygous. Outer Left Sequence: CCAGAATGACCATTCCGTTC. Outer Right Sequence: GGTGAACAGGCAAATCCACT. Inner Left Sequence: TTCACACCTGCTCAAATTGC. Inner Right Sequence: CTGTGGATCCGACAATCCTT. Inner Primer PCR Length: 2315 bp. Deletion Size: 1059 bp. Deletion left flank: ATCAAGTACTTAATGGATTCGTGGGATTAC. Deletion right flank: CATAATTCTCTTGCCACGTATGTAGCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1704 C. elegans F14E5.4(ok2129) II. Show Description
F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1719 C. elegans Y45F10D.13(ok2174) IV. Show Description
Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1742 C. elegans ifb-1(ok2227) II. Show Description
F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1761 C. elegans F10F2.7(ok2264) III. Show Description
F10F2.7. Homozygous. Outer Left Sequence: CACATCCCTCCACCAATTCT. Outer Right Sequence: ATGTACCCGACTGAAGCCTG. Inner Left Sequence: ATTCCACACCCTGCTTTTTG. Inner Right Sequence: GACATGACTTGGCTTGGCTT. Inner Primer PCR Length: 2889 bp. Deletion Size: 912 bp. Deletion left flank: GATTAGATTTTGGGATCCGTTACGGCTAGT. Deletion right flank: CCTCTTGTCACATCAGAATCTGCGTACATG. Insertion Sequence: ATGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1787 C. elegans F56F11.5(ok2305) III. Show Description
F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1820 C. elegans T25F10.6(ok2355) V. Show Description
T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1848 C. elegans F19C6.4(ok2392) X. Show Description
F19C6.4. Homozygous. Outer Left Sequence: AACATTCTGTCCCCTATGCG. Outer Right Sequence: AACCGTACAAAAAGCATGGC. Inner Left Sequence: CAGCCATACAGCGTTTTGAA. Inner Right Sequence: GCCTACGGAGCAGAAGATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1030 bp. Deletion left flank: AAGCGATAATACTCCGTTTCATATACCAGT. Deletion right flank: ATATTAGAGGAGTTTTTTGGGTTGAAAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1888 C. elegans gly-10(ok2439) IV. Show Description
Y45F10D.3. Homozygous. Outer Left Sequence: CACACCAAGCCATACGTCAG. Outer Right Sequence: GCCCATTTTTGGAGATCAGA. Inner Left Sequence: TTTGGCCTCCTAACAAAACG. Inner Right Sequence: GTGCAAAAATCCTTTGCCAT. Inner Primer PCR Length: 3042 bp. Deletion Size: 1037 bp. Deletion left flank: CTTTTTGCAATTCAATTTTCAAATATTTGT. Deletion right flank: GAAATAGAGGCGGGGTGTAGTTTTGCAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1894 C. elegans sri-17(ok2446) I. Show Description
F15H9.3. Homozygous. Outer Left Sequence: CGAAGTAGGCAGGAATGAGG. Outer Right Sequence: TGGAGCACATCGAGTGAGAG. Inner Left Sequence: ACGATAGGCTTTTCCAACCA. Inner Right Sequence: TTCTCTGCGCTCTATCACCA. Inner Primer PCR Length: 1300 bp. Deletion Size: 466 bp. Deletion left flank: AAATTCCAGTTCGCAAGTTTTCTGACAGAA. Deletion right flank: GTCTATAATTACGAGTCTAATCAATGGCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1920 C. elegans mig-10(ok2499) III. Show Description
F10E9.6. Homozygous. Outer Left Sequence: AACACATGGCATTGCAAAAA. Outer Right Sequence: GCAACAGAAGGTGTACGCTG. Inner Left Sequence: TGATATCCGGACAGAGAGGG. Inner Right Sequence: CCAAGGAGTCGGTGATTTGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 2263 bp. Deletion left flank: ACCCACATACCTTATACTTTATCCGAAAAT. Deletion right flank: GTGCTTGAGATATCAATCTAGATGGTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1931 C. elegans feh-1&nhr-239(ok2526) III. Show Description
Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1946 C. elegans C30F12.7(ok2559) I. Show Description
C30F12.7. Homozygous. Outer Left Sequence: GGGTGTTCTTGCACCTGAAT. Outer Right Sequence: TTTGAATTTCCTTTGCCCTG. Inner Left Sequence: AGATGTTCATGAAAACGCCC. Inner Right Sequence: GATTGGTCATGGGGCTCTAA. Inner Primer PCR Length: 2691 bp. Deletion Size: 2003 bp. Deletion left flank: TAGGTTCCCATGCTTGAAAATATAAAGTCT. Deletion right flank: TGTGGGTTTATAAAACTTAATGAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2088 C. elegans F11E6.8(ok2754) IV. Show Description
F11E6.8 Homozygous. Outer Left Sequence: gaatgcatctgagcagcaaa. Outer Right Sequence: gccaggcaagaacagaaaag. Inner Left Sequence: ttagtgaaaagacggcctgg. Inner Right Sequence: tgcggtcaaaacactgaaag. Inner Primer PCR Length: 1244. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2107 C. elegans Y51F10.4(ok2782) I. Show Description
Y51F10.4 Homozygous. Outer Left Sequence: taccggaaattttcaatccg. Outer Right Sequence: ggctaagatcgtgagaccca. Inner Left Sequence: aatttgccaatttgccgtaa. Inner Right Sequence: aatggggaactttgacacca. Inner Primer PCR Length: 1198. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2145 C. elegans tir-1(ok2859) III. Show Description
F13B10.1. Homozygous. Outer Left Sequence: CGGGAGATAGAAGGCATCTG. Outer Right Sequence: ACGGGGCTTAATTTCCTCAT. Inner Left Sequence: AAACCTTCGAAAATCGAGCA. Inner Right Sequence: CTGCCAGTCCTGTTGCTCTT. Inner Primer PCR Length: 1356 bp. Deletion Size: 354 bp. Deletion left flank: ATTTGTGAGCATTTGGTAGGTGTAAACAGA. Deletion right flank: GGAGGCCACTTCTTTTAATGCTTGGATTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2150 C. elegans F13B12.6(ok2881) IV. Show Description
F13B12.6 Homozygous. Outer Left Sequence: cgaacgatgctacgagatga. Outer Right Sequence: aacacggaaaaatcaaacgg. Inner Left Sequence: ctggttgtcttgctgtccaa. Inner Right Sequence: aaaggataccgccgaaaaat. Inner Primer PCR Length: 1294. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2151 C. elegans F17C11.2(ok2895) V. Show Description
F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2156 C. elegans R02F11.1(ok2901) V. Show Description
R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2173 C. elegans F12D9.1(ok2940) X. Show Description
F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2176 C. elegans gly-4(ok2943) V. Show Description
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2184 C. elegans F10A3.1(ok2960) V. Show Description
F10A3.1. Homozygous. Outer Left Sequence: TGCGGACTGCAAATAAAGTG. Outer Right Sequence: CGTGTGCTTTGTACGCTGAT. Inner Left Sequence: TCCCGTTTCTACTTGGTTTTT. Inner Right Sequence: TTCCGAAACAAAATGCACAA. Inner Primer PCR Length: 1208 bp. Deletion Size: 327 bp. Deletion left flank: TTCAGGGTAAGCACTAAATTGAGTTCCGTG. Deletion right flank: GTGTGTAAGCAAGTGCGTTATGAAATTGTG. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2250 C. elegans puf-6(ok3044) II. Show Description
F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2258 C. elegans F17A2.3(ok3059) X. Show Description
F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2260 C. elegans alfa-1(ok3062) II. Show Description
F18A1.6. Homozygous. Outer Left Sequence: GTCGAGACCGAACACCGTAT. Outer Right Sequence: CCACATACGATGCGCTTAAA. Inner Left Sequence: GGCAATATTTTGTGCCTGGT. Inner Right Sequence: TGCCGCTGTTAAAAGACTGA. Inner Primer PCR Length: 1259 bp. Deletion Size: 486 bp. Deletion left flank: GTCATCATTCCAAATGCATCTTCATACTTT. Deletion right flank: GTACTTGTTGTAGCAGATTCAGTCATATAT. Insertion Sequence: CAATCATCCATTGTCAATGTTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2275 C. elegans flp-16(ok3085) II. Show Description
F15D4.8. Homozygous. Outer Left Sequence: TTTTCGAAGCCTGTTAGCGT. Outer Right Sequence: TTTAAGTTTCCACAGGCGCT. Inner Left Sequence: AAAGTCCTGAAAAAGAAGCAGC. Inner Right Sequence: TTGAAAACAACGGTCTCGAA. Inner Primer PCR Length: 1201 bp. Deletion Size: 548 bp. Deletion left flank: CCTAAATTTGATGAATGAGTGTGGATCCGA. Deletion right flank: CCTATAGGCATCATCCATCAAAACCCCACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2277 C. elegans ser-5(ok3087) I. Show Description
F16D3.7. Homozygous. Outer Left Sequence: GGATAAGTACGGGCAACGAA. Outer Right Sequence: AATGCGGAACGTTTGAACTC. Inner Left Sequence: TGGAGAACAATTACCCCCTG. Inner Right Sequence: AGATGATGGGATTGAGCATTG. Inner Primer PCR Length: 1119 bp. Deletion Size: 410 bp. Deletion left flank: ATTGTCACGAAAACAAAAGTAATATCAGTG. Deletion right flank: GAAAGACAAACGGGATGGTGGAGCATCAGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2288 C. elegans gst-8(ok3111) II. Show Description
F11G11.1. Homozygous. Outer Left Sequence: CGAATCATCATGAAAAGGCA. Outer Right Sequence: CATTTCCCACGCTTGAGTCT. Inner Left Sequence: GCGCAGTGGGAAGAGTAAAT. Inner Right Sequence: CCTTCTGCCGCAATTTTACA. Inner Primer PCR Length: 1208 bp. Deletion Size: 482 bp. Deletion left flank: TCAGATGTTTTTTTAGTTGTCATTGGCTTC. Deletion right flank: TGATCCAGCTCTTCTCGAAGAATTCCCACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 [NOTE: (06/03/2021) A user reported the original stock of RB2288 received by the CGC was heterozygous. A homozygous line was isolated and verified by PCR.]
RB2296 C. elegans R09F10.1(ok3119) X. Show Description
R09F10.1 Homozygous. Outer Left Sequence: agcgccaccgtatttaatga. Outer Right Sequence: gttcgggaaactgggatttt. Inner Left Sequence: ccgtgtaaggctgttgatga. Inner Right Sequence: gtatttgcaagaccgcagc. Inner Primer PCR Length: 1290. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2336 C. elegans F13H8.9(ok3172) II. Show Description
F13H8.9. Homozygous. Outer Left Sequence: TCTCAATCGGTGATGATGGA. Outer Right Sequence: AAGGCTGCTGATGCAATTCT. Inner Left Sequence: TCTTCTTAAGACGGGGAGCA. Inner Right Sequence: GAAGCAAGAAGTCATCTCGGA. Inner Primer PCR Length: 1198 bp. Deletion Size: 754 bp. Deletion left flank: CCACACTTGATGTATTTGGAAGTCTCTGGG. Deletion right flank: GAAGTTTTGAAACTTTCTTAGCATTTCTTA. Insertion Sequence: TGCTCGATATTTGTAGTGATAATATGTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2354 C. elegans F15D4.4(ok3200) II. Show Description
F15D4.4 Homozygous. Outer Left Sequence: ggtagatttaaagcgcgtcg. Outer Right Sequence: ttccggaaatatgcaggaag. Inner Left Sequence: agcgcgaaaaattcaatgag. Inner Right Sequence: gttcaattccggcagtttg. Inner Primer PCR Length: 1171. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2407 C. elegans cng-1(ok3292) V. Show Description
F14H8.6 Homozygous. Outer Left Sequence: caggagggtatccccaattt. Outer Right Sequence: gctcgtcgagaaacttttgg. Inner Left Sequence: ccagagtcagtgcagaccag. Inner Right Sequence: tgttcaggcacttcgaggat. Inner Primer PCR Length: 1263. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2408 C. elegans F18A12.6(ok3293) II. Show Description
F18A12.6 Homozygous. Outer Left Sequence: catccggcaacaaacctact. Outer Right Sequence: gttcaacttttccgtcgcat. Inner Left Sequence: gcgaagttctgggcaattta. Inner Right Sequence: tggtttccagtgcttttcag. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2417 C. elegans F14H12.6(ok3312) X. Show Description
F14H12.6 Homozygous. Outer Left Sequence: ggaaatgccaaggcagatta. Outer Right Sequence: tccaacacgaaaatgtgagc. Inner Left Sequence: tttccgtgttttaagataagaacaaa. Inner Right Sequence: ctaaccttctgcatcctcgc. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2427 C. elegans F13H8.11(ok3333) II. Show Description
F13H8.11 Homozygous. Outer Left Sequence: aaccaggagagcttgcaaaa. Outer Right Sequence: cttcttgaaaatggcacggt. Inner Left Sequence: ctgaaggaactcggagaaatc. Inner Right Sequence: gcgtttatggattcaatggg. Inner Primer PCR Length: 1272. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2439 C. elegans F13D2.2(ok3362) X. Show Description
F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2452 C. elegans F11A3.1(ok3391) V. Show Description
F11A3.1 Homozygous. Outer Left Sequence: tgatccaaattgggactgct. Outer Right Sequence: ggattttgtggaaagcaagc. Inner Left Sequence: gaaagctctcttgtttcttcca. Inner Right Sequence: tttgtcaaactgtgccgatt. Inner Primer PCR Length: 1276. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2459 C. elegans F12A10.4(ok3398) II. Show Description
F12A10.4 Homozygous. Outer Left Sequence: tgtgcaatgggaaaaactga. Outer Right Sequence: attttggacgcgatagttgc. Inner Left Sequence: acgattgaggtaggcagtgg. Inner Right Sequence: tggaaggtttgcagacatga. Inner Primer PCR Length: 1278. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2462 C. elegans oct-1(ok3401) I. Show Description
F52F12.1 Homozygous. Outer Left Sequence: catatgcctcgtcctggaac. Outer Right Sequence: ggccatgttcatcagaaggt. Inner Left Sequence: tttctttaccacgaagtaagcg. Inner Right Sequence: tctgaatgtttgaaagtcgca. Inner Primer PCR Length: 1353. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2498 C. elegans nlp-17(ok3461) IV. Show Description
Y45F10A.5 Homozygous. Outer Left Sequence: agcttccggtcaggttcttt. Outer Right Sequence: aaaaggtgaacgatgaacgg. Inner Left Sequence: aaccaccacatttttggtaaaga. Inner Right Sequence: agggggtgacgtttttgagt. Inner Primer PCR Length: 1236. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2502 C. elegans F13D2.2(ok3465) X. Show Description
F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2517 C. elegans F13B12.4(ok3489) IV. Show Description
F13B12.4 Homozygous. Outer Left Sequence: gcgtcgactggtcaattttt. Outer Right Sequence: tcttcgcaatgcaaaagcta. Inner Left Sequence: agcaagcacaaaactcatgc. Inner Right Sequence: cgacaaaaaccacggattcta. Inner Primer PCR Length: 1126. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2519 C. elegans drh-1(ok3495) IV. Show Description
F15B10.2 Homozygous. Outer Left Sequence: tcaccgatccagttgcatta. Outer Right Sequence: aacccaacagtatccctcca. Inner Left Sequence: taatgcttgttgctcatccg. Inner Right Sequence: acacgcaacgcagttttatt. Inner Primer PCR Length: 1136. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2529 C. elegans C30F12.2(ok3505) I. Show Description
C30F12.2 Homozygous. Outer Left Sequence: cgagaactgaatcgtgggat. Outer Right Sequence: ccccaattcgctcaaaatta. Inner Left Sequence: tcattagctgcagattgtttgaa. Inner Right Sequence: tctgcaagttcaacggttttt. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2536 C. elegans F14B8.2(ok3517) X. Show Description
F14B8.2 Homozygous. Outer Left Sequence: gaagcatggggaagaaatga. Outer Right Sequence: ttgctggcagaagttgtacg. Inner Left Sequence: tttgctcattttatgctcatttt. Inner Right Sequence: gccacatttcatgtatcgca. Inner Primer PCR Length: 1113. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807