More Fields
Strain Species Genotype
RB1328 C. elegans dsh-1(ok1445) II. Show Description
C34F11.9. Homozygous. Outer Left Sequence: ATTCTTCCATCCAATGCCAC. Outer Right Sequence: AGTGCATCATGAGCCACAAG. Inner Left Sequence: TGCTCTAGAGGGTTTTCGGA. Inner Right Sequence: GAGAACGACACGATTGCTCA. Inner Primer PCR Length: 3156 bp. Deletion Size: 1132 bp. Deletion left flank: CGGATTCGGAGCCAATTGTTGATTCTTCGA. Deletion right flank: AATGGTGCCTCAGACTCCGGCTCCACACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1366 C. elegans F14D12.5(ok1551) X. Show Description
F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1369 C. elegans F14D12.5(ok1554) X. Show Description
F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1379 C. elegans F11C7.1(ok1564) X. Show Description
F11C7.1 Homozygous. Outer Left Sequence: gcaaacgccaataactggat. Outer Right Sequence: atgtgaaagcctacgccaac. Inner Left Sequence: tgcctgatctctcattgtgc. Inner Right Sequence: atccaattcggtggactcag. Inner Primer PCR Length: 3214. Estimated Deletion Size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1402 C. elegans far-4(ok317) V. Show Description
F15B9.2 Homozygous. Outer Left Sequence: acggagaagaaccaagcaga. Outer Right Sequence: ttcaaacgtgtgatgaggga. Inner Left Sequence: ggcggttcaattcttccata. Inner Right Sequence: agagtggtggcattacctcg. Inner Primer PCR Length: 3041. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1406 C. elegans npp-11(ok1599) I. Show Description
F53F10.5 Homozygous. Outer Left Sequence: ttttaggccatcattttcgc. Outer Right Sequence: cgacgagttgttcgttttca. Inner Left Sequence: ctgctaccacaacagcctca. Inner Right Sequence: tgtggtcatccttcagcttg. Inner Primer PCR Length: 3168. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1410 C. elegans Y45F10B.8(ok1607) IV. Show Description
Y45F10B.8 Homozygous. Outer Left Sequence: cgaaaagcttgcattcacaa. Outer Right Sequence: aggagacccaggaaaccact. Inner Left Sequence: aatcacacctggtctggagg. Inner Right Sequence: gtctcgatgcgtcttgatga. Inner Primer PCR Length: 2233. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1413 C. elegans Y51F10.2(ok1610) I. Show Description
Y51F10.2. Homozygous. Outer Left Sequence: CTTCAGAGCCGTAGGTCAGG. Outer Right Sequence: ACGTTGCACCATGTTCAAAA. Inner Left Sequence: AAAACTGGCGGTATTGATGC. Inner Right Sequence: TTCTGATCCTCCCCCTTCTT. Inner Primer PCR Length: 2508 bp. Deletion Size: 1161 bp. Deletion left flank: CAATTTGCACAAAGTGCAACGCGATTTTCG. Deletion right flank: AATTTTGAGTATAAAATATAATTATCTTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1435 C. elegans F13G3.5(ok1638) I. Show Description
F13G3.5 Homozygous. Outer Left Sequence: ggctcgaaatcgacatgagt. Outer Right Sequence: ttcacaatctggagtgctgg. Inner Left Sequence: cagataaatcgcgtccgagt. Inner Right Sequence: attgaacgaaaaggctggaa. Inner Primer PCR Length: 2192. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1474 C. elegans F19G12.3(ok1725) X. Show Description
F19G12.3 Homozygous. Outer Left Sequence: ccgagctccttcaaagtcac. Outer Right Sequence: gcctgcaactgcactaatca. Inner Left Sequence: gctcattttcataacgggga. Inner Right Sequence: agtgtaccctgcattttggc. Inner Primer PCR Length: 2138. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1478 C. elegans F13B12.3(ok1729) IV. Show Description
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1479 C. elegans F13B12.3(ok1730) IV. Show Description
F13B12.3 Homozygous. Outer Left Sequence: tgggctaaatgcgagtatcc. Outer Right Sequence: tcccacgagttagatgctca. Inner Left Sequence: tgaggaaattgttttcggga. Inner Right Sequence: ctcggtgaattggctcctac. Inner Primer PCR Length: 3098. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1486 C. elegans F13G3.5(ok1743) I. Show Description
F13G3.5. Homozygous. Outer Left Sequence: GGGGGAAATGATGGAAGATT. Outer Right Sequence: TACATCGCAAAATGGGACAA. Inner Left Sequence: GAGAATTGGCGGTAAACGAG. Inner Right Sequence: TTCACAATCTGGAGTGCTGG. Inner Primer PCR Length: 3451 bp. Deletion Size: 1259 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1507 C. elegans Y39F10A.3(ok1777) II. Show Description
Y39F10A.3. Homozygous. Outer Left Sequence: CAACGTCGTGGTATTCGTTG. Outer Right Sequence: AATCGCGAGACAAGAAGCAT. Inner Left Sequence: GATCTGAGGACGCAAATGGT. Inner Right Sequence: TGAGCCATTGACAGAAGCAG. Inner Primer PCR Length: 2145 bp. Deletion Size: 930 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1520 C. elegans F15E6.6(ok1816) IV. Show Description
F15E6.6. Homozygous. Outer Left Sequence: tcctctcacaacatgccaaa. Outer Right Sequence: tcagtagcaacccgtaaccc. Inner Left Sequence: agtgctgcagtcaacaatgg. Inner Right Sequence: aaaatccagaaaccgtggtg. Inner Primer PCR Length: 3224. Deletion Size: 950. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1526 C. elegans srd-44(ok1831) X. Show Description
F17A2.8. Homozygous. Outer Left Sequence: gtggacgactaccaatggct. Outer Right Sequence: tcagacatgggcgaatacaa. Inner Left Sequence: cttgatcagtcgctctcgtg. Inner Right Sequence: cgcaaccattttggagagac. Inner Primer PCR Length: 2335. Deletion Size: 2064. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1530 C. elegans sru-11(ok1835) IV. Show Description
Y45F10B.6. Homozygous. Outer Left Sequence: GCAAATTGGAGATACCCGAA. Outer Right Sequence: CAACGTGTTTTGATGAACGG. Inner Left Sequence: CCCAAATCCCGAGAAGTACA. Inner Right Sequence: AATTCGGCATTGGAAAACAG. Inner Primer PCR Length: 2781 bp. Deletion Size: 746 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1531 C. elegans T23F11.2(ok1836) III. Show Description
T23F11.2. Homozygous. Outer Left Sequence: cacctttctgtaggcgcttc. Outer Right Sequence: ccgtgtgtggttctcctttt. Inner Left Sequence: tcaagaaacccgaccaagtc. Inner Right Sequence: tcctagatggatggacggac. Inner Primer PCR Length: 2160. Deletion Size: 1356. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1540 C. elegans F14F3.2(ok1848) X. Show Description
F14F3.2 Homozygous. Outer Left Sequence: agcaaaaggaatgcgatgac. Outer Right Sequence: gttcccctatcatgccaaaa. Inner Left Sequence: ttctccgttgttttcccaag. Inner Right Sequence: acacgttccgaacctttcac. Inner Primer PCR Length: 3329. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1541 C. elegans pab-2(ok1851) X. Show Description
F18H3.3. Homozygous. Outer Left Sequence: TTTGTTCTGAGCTTGGGCTT. Outer Right Sequence: AATTTTCATGCCCATTCCAA. Inner Left Sequence: GGCCGAACAAATTACCATGT. Inner Right Sequence: AAATGTGGGCGAAAGATGAG. Inner Primer PCR Length: 3336 bp. Deletion Size: 1835 bp. Deletion left flank: AGATTTTTAAATTTTTTTGGGGTTTTTTGT. Deletion right flank: CCTTTGCTGTTTCCTTCATCGTCGGTGGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1544 C. elegans F11A5.4(ok1857) V. Show Description
F11A5.4. Homozygous. Outer Left Sequence: TGCTATGGAAGCGACTGTTG. Outer Right Sequence: TGCTTGCTTCATTTTTCACG. Inner Left Sequence: TTATCCCTTTTCCCCATTCC. Inner Right Sequence: ATACCTGCCATTGGACTTCG. Inner Primer PCR Length: 2332 bp. Deletion Size: 658 bp. Deletion left flank: CACGAGATTTATAGAAAGCTTAACTTTGGA. Deletion right flank: TATGCGCATGGTGGTCTTTGCCGAGTTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1564 C. elegans F19H8.2(ok1898) II. Show Description
F19H8.2. Homozygous. Outer Left Sequence: TTCCCATTTTGCGATTTCTC. Outer Right Sequence: GGTCAAGTGTAAGCCTTGCG. Inner Left Sequence: TGCTGACAATGTGGAGCAGT. Inner Right Sequence: TCGTGTCATCGAGACCACTC. Inner Primer PCR Length: 2127 bp. Deletion Size: 738 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1594 C. elegans str-61&F14F8.8(ok1959) V. Show Description
F14F8.1, F14F8.8. Homozygous. Outer Left Sequence: TTTTCCCAACGTAGTGAGCC. Outer Right Sequence: GCCACAGGGTACGATAGCAT. Inner Left Sequence: AGGTTTTCAAAGTGCGTTCC. Inner Right Sequence: GCACAAAATCTCCCCCACTA. Inner Primer PCR Length: 2153 bp. Deletion Size: 1443 bp. Deletion left flank: AAAAAATTCTTAAAGATTCTGGAAGTTTTC. Deletion right flank: TATCCGGGCCGGCATCTATCTGCTTAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1600 C. elegans tub-1(ok1972) II. Show Description
F10B5.4. Homozygous. Outer Left Sequence: ATGATGATGGGACGGAACAT. Outer Right Sequence: TTTTGACACACCACACGCTT. Inner Left Sequence: TGGGACAAGGAAAATCGAAC. Inner Right Sequence: CGGCTTGTTTCCAATCATTT. Inner Primer PCR Length: 2809 bp. Deletion Size: 1676 bp. Deletion left flank: AATTGCATTGAAACCTTTAAAAAGAGTTTC. Deletion right flank: ATGCTCACAGAAACCGATGAGTTATCAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1627 C. elegans pll-1(ok2003) III. Show Description
K10F12.3. Homozygous. Outer Left Sequence: AAAACACCAATCAGGTTCGC. Outer Right Sequence: TGACCGGATAGAATTCGGAG. Inner Left Sequence: CACATGGCAAATTTAGGGCT. Inner Right Sequence: TTCAAGCAGACCATCTGCAC. Inner Primer PCR Length: 3277 bp. Deletion Size: 1120 bp. Deletion left flank: CAATCTCATGACAGTCGACGGCTTCACATC. Deletion right flank: TACCAATATATGTAATAAAGGACGATAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1649 C. elegans tbck-1(ok2038) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1334 bp. Deletion left flank: CAATAAATACTACACAGATGATCAGGAGAA. Deletion right flank: TTGTCACGGAATCTCAACATTTTGTCTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1650 C. elegans F56F11.2(ok2039) III. Show Description
F56F11.2. Homozygous. Outer Left Sequence: CCGCCAAATCCTTATTTTCA. Outer Right Sequence: TTTTTCTGAATTTTTCGGCG. Inner Left Sequence: TGGAATCCAACAAAACACCA. Inner Right Sequence: TGAACGTGTCTGGGATGAAA. Inner Primer PCR Length: 2864 bp. Deletion Size: 1924 bp. Deletion left flank: GCAGCTGAAGAGCTCTACCGTGTATTTGAA. Deletion right flank: TGCTGACAAAGATGAAGATTTGGCTGAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1657 C. elegans R04F11.1(ok2047) V. Show Description
R04F11.1. Homozygous. Outer Left Sequence: AAATGGCCGATGTGATTGAT. Outer Right Sequence: TTCTCCGTGGGAATTTCAAG. Inner Left Sequence: GCCCATTGTTTTTCCATCTG. Inner Right Sequence: GCCAAAATTTCGAAACTGGA. Inner Primer PCR Length: 2447 bp. Deletion Size: 1294 bp. Deletion left flank: CATGGAACCAAACATGTGTATGTACGTTGC. Deletion right flank: CCTTAGGGCCTGGAACAGCTGAGAATGTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1666 C. elegans tbck-1(ok2064) II. Show Description
C33F10.2. Homozygous. Outer Left Sequence: CCAAACTTCGGAGCATTCAT. Outer Right Sequence: AGCCAATCGATGTCAGCTTC. Inner Left Sequence: CAAACAAATGCTCGGAAGGT. Inner Right Sequence: GGCCTGCATAGAATTTGGAA. Inner Primer PCR Length: 3281 bp. Deletion Size: 1935 bp. Deletion left flank: TGAAAACGGTGGAAGAAATGCGTGCAGCCG. Deletion right flank: GAAATGCATTCCCATTAATGATTGCTCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1687 C. elegans F13B6.1(ok2097) IV. Show Description
F13B6.1. Homozygous. Outer Left Sequence: CCAGAATGACCATTCCGTTC. Outer Right Sequence: GGTGAACAGGCAAATCCACT. Inner Left Sequence: TTCACACCTGCTCAAATTGC. Inner Right Sequence: CTGTGGATCCGACAATCCTT. Inner Primer PCR Length: 2315 bp. Deletion Size: 1059 bp. Deletion left flank: ATCAAGTACTTAATGGATTCGTGGGATTAC. Deletion right flank: CATAATTCTCTTGCCACGTATGTAGCAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1704 C. elegans F14E5.4(ok2129) II. Show Description
F14E5.4. Homozygous. Outer Left Sequence: CTCGACGAATAGACCGATGC. Outer Right Sequence: TTTGGTCAGTTGGCATTTCA. Inner Left Sequence: CCTTTTTCCATCGAAACCAC. Inner Right Sequence: GCGTGCTTCAGAAAGGTGAT. Inner Primer PCR Length: 2170 bp. Deletion Size: 1766 bp. Deletion left flank: TTTTTCCATCGAAACCACAATTTATACTTG. Deletion right flank: TTTGCAAGATAAGCAGGATCGCTGAGACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1719 C. elegans Y45F10D.13(ok2174) IV. Show Description
Y45F10D.13. Homozygous. Outer Left Sequence: CCGAAAAATCAGCCCACTAA. Outer Right Sequence: AATTGCCGTTTCACAAGTCC. Inner Left Sequence: AATTTCAGCCCATCATCTGC. Inner Right Sequence: TACATCTCGGATCCTTTCGG. Inner Primer PCR Length: 2960 bp. Deletion Size: 1110 bp. Deletion left flank: TAAAACCCCAAAATCATCATTGAAAATAAA. Deletion right flank: AAATTGATTACTGTTTCAAAAAGTTATTAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1742 C. elegans ifb-1(ok2227) II. Show Description
F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1761 C. elegans F10F2.7(ok2264) III. Show Description
F10F2.7. Homozygous. Outer Left Sequence: CACATCCCTCCACCAATTCT. Outer Right Sequence: ATGTACCCGACTGAAGCCTG. Inner Left Sequence: ATTCCACACCCTGCTTTTTG. Inner Right Sequence: GACATGACTTGGCTTGGCTT. Inner Primer PCR Length: 2889 bp. Deletion Size: 912 bp. Deletion left flank: GATTAGATTTTGGGATCCGTTACGGCTAGT. Deletion right flank: CCTCTTGTCACATCAGAATCTGCGTACATG. Insertion Sequence: ATGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1787 C. elegans F56F11.5(ok2305) III. Show Description
F56F11.5. Homozygous. Outer Left Sequence: ACAAGCTGAAAATGCCCAAC. Outer Right Sequence: ATTGCCAAAAGTTCGATTGC. Inner Left Sequence: CAGAAATGTCCATGAAATTAACAAA. Inner Right Sequence: CAGGCTCCAGTTCGAAGTTT. Inner Primer PCR Length: 3054 bp. Deletion Size: 2283 bp. Deletion left flank: TAACTCGGCTATAGCCTATAGCCGAGTTTC. Deletion right flank: TAATAGTGCCACACTGTGCGTAATTATTAT. Insertion Sequence: TGAGATTTTTCAACTTTTCAAAAAATCTTATAAAATCTAGAATTTTTTTGAATTTTTTA AGCATGATATTTTGGTCTTTATGGCCCCATAGGCATGTTTTAAAGCAATTCCCACACAT AGTGTAGTCCATCTTTAAGTTTCTATGTATAAAAGTAATTTTTACCATTGCTTTTGCTT TGTAGGCAATCGCCATGATTTCCAGACTTCGTTGAGACTTTTCAATTATATAATCACGG TAAGACTTCGAACTATCTTTTCTTGATTGCGAAAACGAGGATGTGTAGTCAGCTTGCAA TGCTTCTATTGCTTGACGTGGTCCCTGTTCCCCATTCAATTGAAGGTGAGTTATTACCT TACACGCAAGTTGTTCAAGTTCTCTGCAAATTTACAATTGAAAACTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1820 C. elegans T25F10.6(ok2355) V. Show Description
T25F10.6. Homozygous. Outer Left Sequence: TGAATAGACGTGTCGTTGCC. Outer Right Sequence: CCTCATTCTGGGACGTGTTT. Inner Left Sequence: ATGTGGGTGGAGATGATGGT. Inner Right Sequence: TGACGTCGAAGACGAGTACG. Inner Primer PCR Length: 2512 bp. Deletion Size: 1021 bp. Deletion left flank: GACTCCCATCTGGTATGGAATCATTCCCTG. Deletion right flank: CTTGAATTGGGATAATTCCCTCGGATCTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1848 C. elegans F19C6.4(ok2392) X. Show Description
F19C6.4. Homozygous. Outer Left Sequence: AACATTCTGTCCCCTATGCG. Outer Right Sequence: AACCGTACAAAAAGCATGGC. Inner Left Sequence: CAGCCATACAGCGTTTTGAA. Inner Right Sequence: GCCTACGGAGCAGAAGATTG. Inner Primer PCR Length: 3163 bp. Deletion Size: 1030 bp. Deletion left flank: AAGCGATAATACTCCGTTTCATATACCAGT. Deletion right flank: ATATTAGAGGAGTTTTTTGGGTTGAAAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1888 C. elegans gly-10(ok2439) IV. Show Description
Y45F10D.3. Homozygous. Outer Left Sequence: CACACCAAGCCATACGTCAG. Outer Right Sequence: GCCCATTTTTGGAGATCAGA. Inner Left Sequence: TTTGGCCTCCTAACAAAACG. Inner Right Sequence: GTGCAAAAATCCTTTGCCAT. Inner Primer PCR Length: 3042 bp. Deletion Size: 1037 bp. Deletion left flank: CTTTTTGCAATTCAATTTTCAAATATTTGT. Deletion right flank: GAAATAGAGGCGGGGTGTAGTTTTGCAACC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1894 C. elegans sri-17(ok2446) I. Show Description
F15H9.3. Homozygous. Outer Left Sequence: CGAAGTAGGCAGGAATGAGG. Outer Right Sequence: TGGAGCACATCGAGTGAGAG. Inner Left Sequence: ACGATAGGCTTTTCCAACCA. Inner Right Sequence: TTCTCTGCGCTCTATCACCA. Inner Primer PCR Length: 1300 bp. Deletion Size: 466 bp. Deletion left flank: AAATTCCAGTTCGCAAGTTTTCTGACAGAA. Deletion right flank: GTCTATAATTACGAGTCTAATCAATGGCTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1920 C. elegans mig-10(ok2499) III. Show Description
F10E9.6. Homozygous. Outer Left Sequence: AACACATGGCATTGCAAAAA. Outer Right Sequence: GCAACAGAAGGTGTACGCTG. Inner Left Sequence: TGATATCCGGACAGAGAGGG. Inner Right Sequence: CCAAGGAGTCGGTGATTTGT. Inner Primer PCR Length: 3015 bp. Deletion Size: 2263 bp. Deletion left flank: ACCCACATACCTTATACTTTATCCGAAAAT. Deletion right flank: GTGCTTGAGATATCAATCTAGATGGTTCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1931 C. elegans feh-1&nhr-239(ok2526) III. Show Description
Y54F10AM.1, Y54F10AM.2. Homozygous. Outer Left Sequence: ACAACATCCACCATCCACCT. Outer Right Sequence: ATAACCTTATGCCCAAGCCA. Inner Left Sequence: TTTTCAGATTCTAGGCCGTCA. Inner Right Sequence: GAGCCTAAGCCTAAGCCCAC. Inner Primer PCR Length: 3094 bp. Deletion Size: 2350 bp. Deletion left flank: CAAATTAGACTTAGGCTTTAAATTGTTTGT. Deletion right flank: AAACCGGCAAATTGATTTGCCGAATTTGCC. Insertion Sequence: TTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1946 C. elegans C30F12.7(ok2559) I. Show Description
C30F12.7. Homozygous. Outer Left Sequence: GGGTGTTCTTGCACCTGAAT. Outer Right Sequence: TTTGAATTTCCTTTGCCCTG. Inner Left Sequence: AGATGTTCATGAAAACGCCC. Inner Right Sequence: GATTGGTCATGGGGCTCTAA. Inner Primer PCR Length: 2691 bp. Deletion Size: 2003 bp. Deletion left flank: TAGGTTCCCATGCTTGAAAATATAAAGTCT. Deletion right flank: TGTGGGTTTATAAAACTTAATGAAAAACGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2088 C. elegans F11E6.8(ok2754) IV. Show Description
F11E6.8 Homozygous. Outer Left Sequence: gaatgcatctgagcagcaaa. Outer Right Sequence: gccaggcaagaacagaaaag. Inner Left Sequence: ttagtgaaaagacggcctgg. Inner Right Sequence: tgcggtcaaaacactgaaag. Inner Primer PCR Length: 1244. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2107 C. elegans Y51F10.4(ok2782) I. Show Description
Y51F10.4 Homozygous. Outer Left Sequence: taccggaaattttcaatccg. Outer Right Sequence: ggctaagatcgtgagaccca. Inner Left Sequence: aatttgccaatttgccgtaa. Inner Right Sequence: aatggggaactttgacacca. Inner Primer PCR Length: 1198. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2145 C. elegans tir-1(ok2859) III. Show Description
F13B10.1. Homozygous. Outer Left Sequence: CGGGAGATAGAAGGCATCTG. Outer Right Sequence: ACGGGGCTTAATTTCCTCAT. Inner Left Sequence: AAACCTTCGAAAATCGAGCA. Inner Right Sequence: CTGCCAGTCCTGTTGCTCTT. Inner Primer PCR Length: 1356 bp. Deletion Size: 354 bp. Deletion left flank: ATTTGTGAGCATTTGGTAGGTGTAAACAGA. Deletion right flank: GGAGGCCACTTCTTTTAATGCTTGGATTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2150 C. elegans F13B12.6(ok2881) IV. Show Description
F13B12.6 Homozygous. Outer Left Sequence: cgaacgatgctacgagatga. Outer Right Sequence: aacacggaaaaatcaaacgg. Inner Left Sequence: ctggttgtcttgctgtccaa. Inner Right Sequence: aaaggataccgccgaaaaat. Inner Primer PCR Length: 1294. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2151 C. elegans F17C11.2(ok2895) V. Show Description
F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2156 C. elegans R02F11.1(ok2901) V. Show Description
R02F11.1 Homozygous. Outer Left Sequence: atgaagcaactcgccatctc. Outer Right Sequence: agaaagactgggggcaattt. Inner Left Sequence: atccgactttcagctccaga. Inner Right Sequence: aggtgtatccagttgggcag. Inner Primer PCR Length: 1108. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2173 C. elegans F12D9.1(ok2940) X. Show Description
F12D9.1. Homozygous. Outer Left Sequence: TAATGTGGTCCGCACAAAAA. Outer Right Sequence: GAGCAAAGTTGCGATTGTGA. Inner Left Sequence: TTTACTTGTGCATTTTTCCCA. Inner Right Sequence: TAGCGCAGCGTAGTTGGATA. Inner Primer PCR Length: 1192 bp. Deletion Size: 543 bp. Deletion left flank: ACGCGGCCACATTCTTCCCAGTCACGTTTT. Deletion right flank: TTTCAGATGCTGTAATTAGGATTTAGTTGA. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2176 C. elegans gly-4(ok2943) V. Show Description
Y116F11B.12. Homozygous. Outer Left Sequence: TGACACCAGATTTGACGGAA. Outer Right Sequence: CAAAAACCTCCGAAGCACAT. Inner Left Sequence: AAATTTTGCTTTTTGGGCCT. Inner Right Sequence: CCAAATTTTGCGACTTACTATCG. Inner Primer PCR Length: 1177 bp. Deletion Size: 617 bp. Deletion left flank: ATCATCACGGCACAATGAGAAAAGTTGCTC. Deletion right flank: ATTAGATGTCGATAGTAAGTCGCAAAATTT. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807