xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx350 [elt-2p::zif-1 + elt-2p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx350, ZF1::GFP::cdc-42 is degraded and mCherry is expressed in the intestine. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.

sec-5(xn51 [sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of zf1::yfp and unc-119(+) into the sec-5 locus. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST, et al. Development 2014 (in press).

xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx380, ZF1::GFP::cdc-42 is degraded and mCherry is expressed after heatshock. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.

zuIs43[pie-1::GFP::PAR-6::ZF1 + unc-119(+)]. Unc worms. GFP present in early embryos but then degrades in somatic lineages. Rescues Mel phenotype of par-6(zu170).

Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs.

Heterozygotes are Unc and segregate Uncs and dead eggs. nT1 carries a dominant Unc mutation and a recessive lethal mutation. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are Lon and segregate Lon and dead eggs.

zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Worms carrying the transgene are non-Unc and express GFP very weakly in early embryos (only detectable by antibody staining), and later in adherens junctions of epithelial cells.

zuIs58 [unc-119(+) + par-6::PAR-6::ZF1::GFP].

zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.

zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.

Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC

Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).

At 25C, heterozygotes are WT and segregate WT, dead eggs and Dauers (which will give only dead eggs if they exit dauer). e1372 and it46 are both temperature sensitive.

Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.

Heterozygotes are WT and segregate WT, Lon and dead eggs. Hets are slow growing and sick.

hEx15 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 39% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx26 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 53% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

aBoc and Exp defective. Slow growth and small brood size. tgDf1 deletes aex-1 and lrp-1.

Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.

Reduced lifespan and reduced mitochondrial membrane potential. Transmitochondrial cybrid worm strain was bred to be homoplasmic for the CB4856 mtDNA genome in the N2 nuclear background. Reference: Dingley SD, et al. J Mol Biol. 2014 May 29;426(11):2199-216.

Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. mcDf1 homozygotes arrest as dead eggs.

WT strain which throws WT and dead eggs. Sick and slow growing!!!

qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.

drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

otIs356 [rab-3p(prom1)::2xNLS::TagRFP] V. CUT Sextuple mutant animals show reduced pan-neuronal gene expression, impaired locomotion and resistance to aldicarb induced paralysis. otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341.

otIs790 [UPN::npp-9::mCherry::blrp::3xflag]. otIs790 contains a pan-neuronal INTACT tag for pull-down of all neuronal nuclei. CUT sextuple-mutant background. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.

Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.

Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).

syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).

fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.

rrrIs1 [pie-1p::GFP::Histone H2B::cye-1 3'UTR + unc-119(+)]. Slightly Unc.

T05F1.4 Homozygous. Outer Left Sequence: tgctgatgtagtcgacggag. Outer Right Sequence: acaataacccagacgcgaac. Inner Left Sequence: attcttggcaaagctcctga. Inner Right Sequence: gcaaaacttcgtgtttgggt. Inner Primer PCR Length: 2312. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01F1.4 Homozygous. Outer Left Sequence: ctactgggcgaaagttcgag. Outer Right Sequence: caacgacgaaactgtgatcg. Inner Left Sequence: tttgggtcctggaaagaaaa. Inner Right Sequence: ttctagcacacggatgatgc. Inner Primer PCR Length: 2295. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22F1.1 Homozygous. Outer Left Sequence: ccaagaaacgatcggactgt. Outer Right Sequence: attgtgtgttgcgttggaaa. Inner Left Sequence: cacgttggagaaacagacga. Inner Right Sequence: ttgggagggtgagaagacac. Inner Primer PCR Length: 2159. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44F1.1 Homozygous. Outer Left Sequence: gttgagtcttttaccccgca. Outer Right Sequence: cattgattgcacggatgaag. Inner Left Sequence: caaaattgtctactgcgcca. Inner Right Sequence: cttcgcgacaatcctaggtc. Inner Primer PCR Length: 3063. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05F1.5. Homozygous. Outer Left Sequence: CTCACATTCACCCAGTGTGC. Outer Right Sequence: AACATCCCAACCACGAACTC. Inner Left Sequence: TTGGTGAGTACACCCTGAACA. Inner Right Sequence: TATTGCAAGTTGTTTTGCGG. Inner Primer PCR Length: 3142 bp. Deletion Size: 1240 bp. Deletion left flank: CCATTTGTCGTCAGGAACATTGGCTAGAAA. Deletion right flank: TGCACATATCTTCTGTTAAATTGTCCTTTT. Insertion Sequence: CATATTTTTTGTTAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05F1.6 Homozygous. Outer Left Sequence: atcaatgctcggagtgttcc. Outer Right Sequence: tccggtagtggcttctcact. Inner Left Sequence: tgtgcatggaaatcacaggt. Inner Right Sequence: ttctggtaatacgaacaccaaca. Inner Primer PCR Length: 1188. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01F1.1. Homozygous. Outer Left Sequence: GGAATTGACACCCTTGCTGT. Outer Right Sequence: AAAGCAGTGGAAATCGGAAA. Inner Left Sequence: AGTGTAGGGACATGCTTGGG. Inner Right Sequence: ATGCGCCTTTAAAAATCGAG. Inner Primer WT PCR product: 3312. Deletion size: 693 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807