More Fields
Strain Species Genotype
FT1523 C. elegans sec-5(xn51[sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of zf1::yfp and unc-119(+) into the sec-5 locus. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST, et al. Development 2014 (in press).
FT1547 C. elegans unc-119(ed3) III; xnIs23; xnEx380. Show Description
xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. xnEx380 [hsp-16.41p::zif-1::SL2::mCherry + rol-6(su1006)]. Pick Rollers to maintain. ZF1::GFP::cdc-42 is expressed ubiquitously and enriched at the plasma membrane. In embryos inheriting xnEx380, ZF1::GFP::cdc-42 is degraded and mCherry is expressed after heatshock. Reference: Armenti ST, et al. Development. 2014 Dec;141(23):4640-7.
FT36 C. elegans unc-101(m1) par-6(zu170) I; zuIs43. Show Description
zuIs43[pie-1::GFP::PAR-6::ZF1 + unc-119(+)]. Unc worms. GFP present in early embryos but then degrades in somatic lineages. Rescues Mel phenotype of par-6(zu170).
GE1825 C. elegans tDf1/unc-32(e189) dpy-18(e499) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs.
GS357 C. elegans unc-42(e270) arDf1 V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. nT1 carries a dominant Unc mutation and a recessive lethal mutation. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HR890 C. elegans +/szT1 [lon-2(e678)] I; syDf1/szT1 X. Show Description
Heterozygotes are Lon and segregate Lon and dead eggs.
JJ1440 C. elegans unc-119(ed3) III; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Worms carrying the transgene are non-Unc and express GFP very weakly in early embryos (only detectable by antibody staining), and later in adherens junctions of epithelial cells.
JJ1494 C. elegans unc-119(ed3) III; zuIs58. Show Description
zuIs58 [unc-119(+) + par-6::PAR-6::ZF1::GFP].
JJ1578 C. elegans par-6(zu222) unc-101(m1); zuIs54. Show Description
zuIs54 [par-6p::par-6::ZF1::GFP + unc-119(+)]. Unc. GFP-tagged PAR-6 that degrades in early embryonic somatic cells; rescues the Par phenotype of par-6(zu222). Delayed gastrulation of endodermal cells. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
JJ1600 C. elegans par-3(it71) lon-1(e185) III; him-8(e1489) IV; zuIs20. Show Description
zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.
JR113 C. elegans sma-1(e30) unc-76(e911) wDf2/sqt-3(sc8) unc-61(e228) V. Show Description
Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).
JR1763 C. elegans wcDf1 dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
At 25C, heterozygotes are WT and segregate WT, dead eggs and Dauers (which will give only dead eggs if they exit dauer). e1372 and it46 are both temperature sensitive.
JR41 C. elegans unc-76(e911) wDf1/unc-61(e228) dpy-21(e428) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.
JR423 C. elegans rhDf1/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.
JT5516 C. elegans saDf1/lon-1(e185) III. Show Description
Heterozygotes are WT and segregate WT, Lon and dead eggs. Hets are slow growing and sick.
KR2361 C. elegans unc-11(e47) I; hEx15. Show Description
hEx15 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 39% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR2362 C. elegans unc-11(e47) I; hEx26. Show Description
hEx26 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 53% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KY5353 C. elegans tgDf1 I. Show Description
aBoc and Exp defective. Slow growth and small brood size. tgDf1 deletes aex-1 and lrp-1.
LA62 C. elegans byDf1 X. Show Description
Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.
MJF1 C. elegans chpIR1 (M, CB4856 > N2). Show Description
Reduced lifespan and reduced mitochondrial membrane potential. Transmitochondrial cybrid worm strain was bred to be homoplasmic for the CB4856 mtDNA genome in the N2 nuclear background. Reference: Dingley SD, et al. J Mol Biol. 2014 May 29;426(11):2199-216.
ML335 C. elegans dpy-2(e489) mcDf1 unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. mcDf1 homozygotes arrest as dead eggs.
NJ654 C. elegans rhDf1 III;sDp3 (III;f). Show Description
WT strain which throws WT and dead eggs. Sick and slow growing!!!
OG528 C. elegans hsf-1(sy441) I; drSi12 II. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
PD8601 C. elegans ccDf1/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PHX1446 C. elegans nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. Show Description
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PJ801 C. elegans jDf1/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.
PS1032 C. elegans syDf1/unc-2(e55) lon-2(e678) X. Show Description
Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS7055 C. elegans syTi1 X. Show Description
syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).
PS7058 C. elegans syTi2 II. Show Description
syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
PX623 C. elegans fxDf1 II; him-5(e1490) V. Show Description
fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.
RAF1 C. elegans unc-119(ed3) III; rrrIs1. Show Description
rrrIs1 [pie-1p::GFP::Histone H2B::cye-1 3'UTR + unc-119(+)]. Slightly Unc.
RB1273 C. elegans T05F1.4(ok1364) I. Show Description
T05F1.4 Homozygous. Outer Left Sequence: tgctgatgtagtcgacggag. Outer Right Sequence: acaataacccagacgcgaac. Inner Left Sequence: attcttggcaaagctcctga. Inner Right Sequence: gcaaaacttcgtgtttgggt. Inner Primer PCR Length: 2312. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1345 C. elegans coq-4(ok1490) I. Show Description
T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1370 C. elegans F01F1.4(ok1555) III. Show Description
F01F1.4 Homozygous. Outer Left Sequence: ctactgggcgaaagttcgag. Outer Right Sequence: caacgacgaaactgtgatcg. Inner Left Sequence: tttgggtcctggaaagaaaa. Inner Right Sequence: ttctagcacacggatgatgc. Inner Primer PCR Length: 2295. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1371 C. elegans hil-3(ok1556) X. Show Description
F22F1.1 Homozygous. Outer Left Sequence: ccaagaaacgatcggactgt. Outer Right Sequence: attgtgtgttgcgttggaaa. Inner Left Sequence: cacgttggagaaacagacga. Inner Right Sequence: ttgggagggtgagaagacac. Inner Primer PCR Length: 2159. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1480 C. elegans T05F1.1(ok1731) I. Show Description
T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1497 C. elegans F44F1.1(ok1765) I. Show Description
F44F1.1 Homozygous. Outer Left Sequence: gttgagtcttttaccccgca. Outer Right Sequence: cattgattgcacggatgaag. Inner Left Sequence: caaaattgtctactgcgcca. Inner Right Sequence: cttcgcgacaatcctaggtc. Inner Primer PCR Length: 3063. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1746 C. elegans C15F1.5(ok2231) II. Show Description
C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1949 C. elegans tra-2(ok2563) II. Show Description
C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1983 C. elegans K05F1.5(ok2617) II. Show Description
K05F1.5. Homozygous. Outer Left Sequence: CTCACATTCACCCAGTGTGC. Outer Right Sequence: AACATCCCAACCACGAACTC. Inner Left Sequence: TTGGTGAGTACACCCTGAACA. Inner Right Sequence: TATTGCAAGTTGTTTTGCGG. Inner Primer PCR Length: 3142 bp. Deletion Size: 1240 bp. Deletion left flank: CCATTTGTCGTCAGGAACATTGGCTAGAAA. Deletion right flank: TGCACATATCTTCTGTTAAATTGTCCTTTT. Insertion Sequence: CATATTTTTTGTTAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2246 C. elegans T11F1.9(ok3040) II. Show Description
T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2322 C. elegans K05F1.6(ok3154) II. Show Description
K05F1.6 Homozygous. Outer Left Sequence: atcaatgctcggagtgttcc. Outer Right Sequence: tccggtagtggcttctcact. Inner Left Sequence: tgtgcatggaaatcacaggt. Inner Right Sequence: ttctggtaatacgaacaccaaca. Inner Primer PCR Length: 1188. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2441 C. elegans uba-5(ok3364) I. Show Description
T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB916 C. elegans gly-14(ok787). Show Description
M01F1.1. Homozygous. Outer Left Sequence: GGAATTGACACCCTTGCTGT. Outer Right Sequence: AAAGCAGTGGAAATCGGAAA. Inner Left Sequence: AGTGTAGGGACATGCTTGGG. Inner Right Sequence: ATGCGCCTTTAAAAATCGAG. Inner Primer WT PCR product: 3312. Deletion size: 693 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB982 C. elegans flp-21(ok889) V. Show Description
C26F1.10. Homozygous. Outer Left Sequence: TCTGATGCGTTTACAGTCGG. Outer Right Sequence: TTTTCTTGTTCAACGGCCTC. Inner Left Sequence: TTAAGCGGAGCACACTTCCT. Inner Right Sequence: GGCAATTGAAAATTGTTGCC. Inner Primer WT PCR product: 3182. Deletion size: 1786 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3109 C. elegans F23F1.5(ve609[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous sterile. Deletion of 1538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ sterile adults (ve609 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults.
RG3123 C. elegans veDf1 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. Show Description
Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3156 C. elegans +/nT1 [umnIs49] IV; F53F1.2(ve656[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that lay dead eggs (ve656 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RW11781 C. elegans unc-119(tm4063) III; stIs11781. Show Description
stIs11781 [F23F1.1::H1-wCherry + unc-119(+)].
RW11980 C. elegans unc-119(tm4063) III; stIs11980. Show Description
stIs11980 [K05F1.5::H1-wCherry + unc-119(+)].