More Fields
Strain Species Genotype
DWF1109 Acrobeloides thornei Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]
DWF1110 Acrobeloides ellesmerensis Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.
DWF1301 Cephalobus sp. Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
DWF1501 Dolichorhabditis sp. Show Description
Isolated in Brazil.
DWF1604 Operculrhabditis sp. Show Description
Originally from UCR collection. Identification by E. Mae Noffsinger.
DWF1701 Zeldia sp. Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
DY164 C. elegans unc-32(e189) syIs80 III; him-8(e1489) IV. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.
EG4181 C. briggsae Show Description
Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16.
EG8872 C. elegans oxTi920 I; unc-119(ed3) III. Show Description
oxTi920 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:1.60). Insertion into C30F12.5. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8882 C. elegans oxTi930 II; unc-119(ed3) III. Show Description
oxTi930 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.05). Insertion into F15A4.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8937 C. elegans oxTi998 V. Show Description
oxTi998 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.23). Insertion into F14D7.14. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EGD226 C. elegans egxSi101 II; unc-119(ed3) III. Show Description
egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017.
EM128 C. elegans mab-21(bx53) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Slightly shorter than WT. mab-21(bx53)/yDf10 is embryonically lethal with embryo arrest at 2 fold stage.
ENL62 C. elegans daf-16(mu86) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CF1038.
ENL67 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.
EU626 C. elegans rfl-1(or198) III. Show Description
Temperature sensitive maternal effect lethal mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.
EV190 C. elegans gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.
FF10 C. elegans dpy-6(f10) X. Show Description
Dpy. Semi-sterile. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]
FF11 C. elegans dpy-6(f11) X. Show Description
Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]
FF14 C. elegans dpy-1(f14) III. Show Description
Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]
FF17 C. elegans dpy-6(f17) X. Show Description
Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]
FF18 C. elegans dpy-6(f18) X. Show Description
Dpy. Bergerac background. [NOTE: Presumably sterile at 25°C because of temperature-sensitive zyg-12(ct350) in the background (Malone et al., Cell 2003).]
FF275 C. elegans dpy-17(e164) unc-32(f123) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and embryonic lethals (f123 homozygotes)
FF276 C. elegans dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit
FF451 C. elegans unc-32(f131) III. Show Description
Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit.
FX19134 C. elegans tmIn8 II. Show Description
Break points: In(F13D12.6 Y51H1A.2) II. Covered region (Mb) 2.1 (11.7..13.9) Obtained by TMP/UV. (Note: Y51H1A.2 has been renamed cup-14.) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30218 C. elegans tmC30 [ubc-17(tmIs1247)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30229 C. elegans tmC30 X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30236 C. elegans tmC30 [ubc-17(tmIs1243)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
GB244 C. elegans unc-96(sf18) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-98. Phenotype (needles and accumulations of paramyosin) is suppressed by growth at 15C or by starvation.
GB246 C. elegans unc-98(sf19) X. Show Description
Adults are Unc - reduced motility; characteristic birefrigent "needles" in body wall muscle cells by polarized light microscopy; contain accumulations of paramyosin and UNC-96.
GE2204 C. elegans unc-32(e189) tDf10/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs, and males. tDf10 is embryonic lethal.
GLW95 C. elegans F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
HA307 C. elegans lin-15B&lin-15A(n765) X; rtEx224. Show Description
rtEx224 [F18E9.2::GFP + lin-15(+)]. Maintain by picking non-Muv. Maintain at 20C.
HS1337 C. elegans osIs1. Show Description
osIs1 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG II. This strain has Ste, Emb, Muv, Him phenotypes (probably dominant effects of the integration). Expression in many blast cells can be detected. Reference: Fujita et al. PLoS ONE 2, e407 (2007).
HS1339 C. elegans osIs2. Show Description
osIs2 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG X. No dominant phenotypes observed (see HS1337). Expression in many blast cells can be detected, but much weaker than osIs1. Reference: Fujita et al. PLoS ONE 2, e407 (2007).
IK589 C. elegans ttx-7(nj50) I. Show Description
Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.
IK591 C. elegans ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
JEL446 C. briggsae Cbr-met-2(xoe1) III. Show Description
Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.
JEL447 C. briggsae Cbr-met-2(xoe2) III. Show Description
Inappropriate targeting of H3K9me2 and H3K9me3. Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.
JK1547 C. elegans ces-1(n703) qDf10/unc-13(e1091) lin-11(n566) I. Show Description
Heterozgotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1548 C. elegans ces-1(n703) qDf11/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are Ces and segregate Ces, UncVul and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1550 C. elegans ces-1(n703) qDf12/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are Ces and segregate VulUnc and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1556 C. elegans ces-1(n703) qDf14/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are Ces and segregate Ces, UncVul and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1557 C. elegans ces-1(n703) qDf13/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1561 C. elegans ces-1(n703) qDf15/unc-29(e193) mec-8(e398) lin-11(n566) I. Show Description
Heterozygotes are Ces and segregate VulUncs and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1726 C. elegans qDf16/dpy-5(e61) unc-15(e1402) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. Maintain by picking WT. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK5556 C. elegans F17E5.2(q864) X. Show Description
350 bp deletion in F17E5.2
JLF104 C. elegans zyg-9(wow12[ZF::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF14 C. elegans gip-1(wow3[GFP::gip-1]) III Show Description
GFP tag inserted into endogenous gip-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.