More Fields
Strain Species Genotype
CF1724 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs105. Show Description
muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1756 C. elegans ptp-3(mu245) muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.
CF1806 C. elegans ceh-20(mu290) III; muEx261. Show Description
muEx261[ceh-20::GFP at C terminus + odr-1::RFP].
CF1814 C. elegans rrf-3(pk1426) II; daf-2(e1370) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CF1824 C. elegans muEx265. Show Description
muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain.
CF1827 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx268. Show Description
muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.
CF1844 C. elegans rrf-3(b26) II; daf-2(mu150) III; fem-1(hc17) IV. Show Description
Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.
CF1864 C. elegans daf-10(mu377) IV. Show Description
Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C.
CF1874 C. elegans daf-16(mu86) I; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva.
CF1880 C. elegans daf-16(mu86) I; glp-1(e2141) III. Show Description
Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
CF1903 C. elegans glp-1(e2144) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]
CF1935 C. elegans daf-16(mu86) I; glp-1(e2141) III; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.
CF196 C. elegans muIs3 V. Show Description
muIs3 [mab-5::lacZ + rol-6(su1006)] V. Rollers.
CF1980 C. elegans rrf-3(pk1426) II; daf-2(e1368) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CGC81 C. elegans C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC83 C. elegans tmIn8 [umnIs64] II. Show Description
umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.
CH120 C. elegans cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
CL2166 C. elegans dvIs19 III. Show Description
dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.
CL6180 C. elegans smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL691 C. elegans dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
COP1626 C. elegans ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
CP161 C. briggsae Cbr-unc-119(nm67) III; nmIs7. Show Description
nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
CP36 C. briggsae Cbr-fem-2(nm27) III. Show Description
XX animals have no obvious phenotype: self-fertile with normal brood size. XO animals are self-fertile hermaphrodites with low brood size and some somatic gonad defects. Cbr-fem-2/+ XO animals show late-onset germline feminization. AF16 was the parental strain.
CP99 C. briggsae Cbr-unc-119(nm67) III. Show Description
Derived from AF16. Outcrossed >6x to AF16. Unc, slightly Dpy, no dauer formation (similar to C. elegans unc-119). nm67 is a deletion (827 bp) in Cbr-119 begining in exon 1 and ending 3' of exon 4. Reference: Liu Q, et al. Development. 2012 Apr;139(8):1509-21.
CX2914 C. elegans nDf16/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The DpyUncs will outgrow the hets.
DA1046 C. elegans hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f). Show Description
Animals carrying sDp2 are Unc and segregate Unc and dead eggs.
DA1060 C. elegans +/eT1 III; adDf1059/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.
DA1649 C. elegans lin-15B&lin-15A(n765) X; adEx1649. Show Description
adEx1649 [F14D12.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA496 C. elegans sDf10 unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
DA686 C. elegans nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]
DM3010 C. elegans unc-112(r367) V; raDf10/+ X. Show Description
The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.
DM3011 C. elegans unc-112(r367) V; raDf11/+ X. Show Description
The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.
DM3012 C. elegans unc-112(r367) V; raDf12/+ X. Show Description
The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.
DM7066 C. elegans pha-1(e2123) III; raEx66. Show Description
raEx66 [T05G5.1p::F46F11.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7207 C. elegans pha-1(e2123) III; raEx207. Show Description
raEx207 [T05G5.1p::F15G9.1(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7229 C. elegans pha-1(e2123) III; raEx229. Show Description
raEx229 [T05G5.1p::F13B12.1(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7230 C. elegans pha-1(e2123) III; raEx230. Show Description
raEx230 [T05G5.1p::R04F11.5(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7232 C. elegans pha-1(e2123) III; raEx322. Show Description
raEx322 [T05G5.1p::F52F12.3(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7254 C. elegans pha-1(e2123) III; raEx254. Show Description
raEx254 [T05G5.1p::F14B6.2(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7285 C. elegans pha-1(e2123) III; raEx285. Show Description
raEx285 [T05G5.1p::C04F12.3(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7286 C. elegans pha-1(e2123) III; raEx286. Show Description
raEx286 [T05G5.1p::F13D12.4(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7330 C. elegans pha-1(e2123) III; raEx330. Show Description
raEx330 [T05G5.1p::Y38F1A.9(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7334 C. elegans pha-1(e2123) III; raEx334. Show Description
raEx334 [T05G5.1p::F53F10.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7340 C. elegans pha-1(e2123) III; raEx340. Show Description
raEx340 [T05G5.1p::C04F12.8(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DP132 C. elegans edIs6 IV. Show Description
edIs6 [unc-119::GFP + rol-6(su1006)] IV. Strong Roller phenotype. Hets are not Rollers (despite the presence of the supposedly dominant su1006 mutation in the array), so heterozygous males mate well. edIs6 is the integration of an array carrying pDP#MMUGF12 and pRF4. pDP#MMUGD12 ia an unc-119::GFP fusion that encodes 101 aa of UNC-119 and was made from the Fire lab vector pPD95.77. pRF4 is the rol-6(su1006) plasmid that gives a Rol phenotype. This strain allows the nervous system to be visualized by GFP fluorescence. GFP expression starts in the early embryo and continues through adulthood in most, if not all, of the nervous system. The expression of a similar lacZ fusion (but carrying a nuclear localizing signal) is described in Genetics 141: 977-988 1995.
DR918 C. elegans mDf10/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, early larval lethals and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
DWF1105 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger.
DWF1106 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.
DWF1107 Acrobeloides butschlii Show Description
Original sample from peach orchard at Lodi CA. Original culture sent to DWF from B. Jaffee. Identification by E. Mae Noffsinger.
DWF1108 Acrobeloides sp. Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.