More Fields
Strain Species Genotype
CF1980 C. elegans rrf-3(pk1426) II; daf-2(e1368) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CGC81 C. elegans C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC83 C. elegans tmIn8 [umnIs64] II. Show Description
umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.
CH120 C. elegans cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
CL2166 C. elegans dvIs19 III. Show Description
dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.
CL6180 C. elegans smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66.
CL691 C. elegans dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
COP1626 C. elegans ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact for more information.
CP161 C. briggsae Cbr-unc-119(nm67) III; nmIs7. Show Description
nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
CP36 C. briggsae Cbr-fem-2(nm27) III. Show Description
XX animals have no obvious phenotype: self-fertile with normal brood size. XO animals are self-fertile hermaphrodites with low brood size and some somatic gonad defects. Cbr-fem-2/+ XO animals show late-onset germline feminization. AF16 was the parental strain.
CP99 C. briggsae Cbr-unc-119(nm67) III. Show Description
Derived from AF16. Outcrossed >6x to AF16. Unc, slightly Dpy, no dauer formation (similar to C. elegans unc-119). nm67 is a deletion (827 bp) in Cbr-119 begining in exon 1 and ending 3' of exon 4. Reference: Liu Q, et al. Development. 2012 Apr;139(8):1509-21.
CX2914 C. elegans nDf16/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The DpyUncs will outgrow the hets.
DA1046 C. elegans hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f). Show Description
Animals carrying sDp2 are Unc and segregate Unc and dead eggs.
DA1060 C. elegans +/eT1 III; adDf1059/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.
DA1649 C. elegans lin-15B&lin-15A(n765) X; adEx1649. Show Description
adEx1649 [F14D12.6::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.
DA496 C. elegans sDf10 unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
DA686 C. elegans nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]
DM3010 C. elegans unc-112(r367) V; raDf10/+ X. Show Description
The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.
DM3011 C. elegans unc-112(r367) V; raDf11/+ X. Show Description
The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.
DM3012 C. elegans unc-112(r367) V; raDf12/+ X. Show Description
The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.
DM7066 C. elegans pha-1(e2123) III; raEx66. Show Description
raEx66 [F46F11.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7207 C. elegans pha-1(e2123) III; raEx207. Show Description
raEx207 [F15G9.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7229 C. elegans pha-1(e2123) III; raEx229. Show Description
raEx229 [F13B12.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7230 C. elegans pha-1(e2123) III; raEx230. Show Description
raEx230 [R04F11.5::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7232 C. elegans pha-1(e2123) III; raEx322. Show Description
raEx322 [F52F12.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7254 C. elegans pha-1(e2123) III; raEx254. Show Description
raEx254 [F14B6.2::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7285 C. elegans pha-1(e2123) III; raEx285. Show Description
raEx285 [C04F12.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7286 C. elegans pha-1(e2123) III; raEx286. Show Description
raEx286 [F13D12.4::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7330 C. elegans pha-1(e2123) III; raEx330. Show Description
raEx330 [Y38F1A.9::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7334 C. elegans pha-1(e2123) III; raEx334. Show Description
raEx334 [F53F10.1::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7340 C. elegans pha-1(e2123) III; raEx340. Show Description
raEx340 [C04F12.8::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DP132 C. elegans edIs6 IV. Show Description
edIs6 [unc-119::GFP + rol-6(su1006)] IV. Strong Roller phenotype. Hets are not Rollers (despite the presence of the supposedly dominant su1006 mutation in the array), so heterozygous males mate well. edIs6 is the integration of an array carrying pDP#MMUGF12 and pRF4. pDP#MMUGD12 ia an unc-119::GFP fusion that encodes 101 aa of UNC-119 and was made from the Fire lab vector pPD95.77. pRF4 is the rol-6(su1006) plasmid that gives a Rol phenotype. This strain allows the nervous system to be visualized by GFP fluorescence. GFP expression starts in the early embryo and continues through adulthood in most, if not all, of the nervous system. The expression of a similar lacZ fusion (but carrying a nuclear localizing signal) is described in Genetics 141: 977-988 1995.
DR918 C. elegans mDf10/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, early larval lethals and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
DWF1105 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger.
DWF1106 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.
DWF1107 Acrobeloides butschlii Show Description
Original sample from peach orchard at Lodi CA. Original culture sent to DWF from B. Jaffee. Identification by E. Mae Noffsinger.
DWF1108 Acrobeloides sp. Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.
DWF1109 Acrobeloides thornei Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]
DWF1110 Acrobeloides ellesmerensis Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.
DWF1301 Cephalobus sp. Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
DWF1501 Dolichorhabditis sp. Show Description
Isolated in Brazil.
DWF1604 Operculrhabditis sp. Show Description
Originally from UCR collection. Identification by E. Mae Noffsinger.
DWF1701 Zeldia sp. Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
DY164 C. elegans unc-32(e189) syIs80 III; him-8(e1489) IV. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.
EG4181 C. briggsae Show Description
Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16.
EG8872 C. elegans oxTi920 I; unc-119(ed3) III. Show Description
oxTi920 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:1.60). Insertion into C30F12.5. Please see for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8882 C. elegans oxTi930 II; unc-119(ed3) III. Show Description
oxTi930 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.05). Insertion into F15A4.2. Please see for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8937 C. elegans oxTi998 V. Show Description
oxTi998 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.23). Insertion into F14D7.14. Please see for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.
EGD226 C. elegans egxSi101 II; unc-119(ed3) III. Show Description
egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017.
EM128 C. elegans mab-21(bx53) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Slightly shorter than WT. mab-21(bx53)/yDf10 is embryonically lethal with embryo arrest at 2 fold stage.