More Fields
Strain Species Genotype
VH742 C. elegans tsn-1(hd42) II. Show Description
F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.
VK1770 C. elegans vkEx1770. Show Description
vkEx1770 [nhx-2p::F13D12.6::YFP + nhx-2p::DsRed::KDEL]. YFP+ intestine. Reticular dsRed expression in intestine. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1870 C. elegans vkEx1870. Show Description
vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VP596 C. elegans dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
WF1131 C. elegans cam-1(gm105) II. Show Description
cam-1 hypomorph. Grows best at 15C.
WF1828 C. elegans hda-1(cw2) II. Show Description
hda-1(cw2) mutants are viable as homozygotes, although many die as embryos or larvae. Severely uncoordinated with defective vulval development and reduced fertility. Reference: Zinovyeva AY, et al. Dev Biol. 2006 Jan 1;289(1):229-42. PMID: 16313898
WF1863 C. elegans cam-1(gm122); cwEx266. Show Description
cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background.
WHY8 C. briggsae Cbr-prg-1(how21) I. Show Description
C. briggsae strain. Reduced fecundity at 20°C and 25°C. Generated by CRISPR/Cas9 in AF16 background, prg-1(how21) is a 5 bp deletion located 47 bp downstream of the start codon that causes frameshift. prg-1(how21) is presumed null; consistent with previous findings that the stability of piRNAs and Piwi protein are co-dependent in C. elegans, the overall abundance of 21 U-RNAs in Cbr-prg-1(how21) was reduced to ~1% of wild-type. Reference: Pastore B, et al. RNA Biol. 2022 Jan;19(1):1276-1292. doi: 10.1080/15476286.2022.2149170.
WJA1004 C. elegans unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Unc. Reporter for no-go mRNA decay. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369.
WJA1025 C. elegans rps-10(srf1025[rps-10::3xHA]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA1097 C. elegans rps-10(srf0825[K125R]) rps-20(srf1046[K6R+K9R]) unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Nuclear body wall muscle GFP+.
WJA1190 C. elegans rps-20(srf1190[rps-20::3xFLAG]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WM153 C. elegans vsra-1(tm1637) I. Show Description
Somatic RNAi deficient. vsra-1 is also known as csr-2/C04F12.1.
XF110 C. elegans polk-1(lf29) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
XF132 C. elegans polh-1(lf31) III. Show Description
Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.
ZF1092 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.32°N, 103.82°E) on 7/19/2006.
ZF1222 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.45°N, 103.72°E) on 7/19/2007.
ZT24 C. elegans vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT56 C. elegans fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT61 C. elegans vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.