| SD1751 |
C. elegans |
egl-27(we3) II; wgIs177. Show Description
wgIs177 [egl-27p::TY1::EGFP::3xFLAG + unc-119(+)]. Maintain at 20C or higher. Embryonic lethal at 15C. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
|
|
| SD1809 |
C. elegans |
elt-3(vp1) X; ccIs4251; stIs10161. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or lower. Dauer formation at 25C. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
|
|
| SD1827 |
C. elegans |
unc-119(ed3) III; gaEx230. Show Description
gaEx230 [sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
|
|
| SD1862 |
C. elegans |
egl-27(we3) II; ccIs4251; stIs10161. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or higher. Embryonic lethal at 15C. mCherry should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
|
|
| SD1901 |
C. elegans |
unc-119(ed3) III; gaEx214. Show Description
gaEx214 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD1903 |
C. elegans |
unc-119(ed3) III; gaEx218. Show Description
gaEx218 [sod-3p::mCherry + aakg-2(sta2) + lys-1p::lyz(D. rerio) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD371 |
C. elegans |
gaIs27. Show Description
gaIs27 [let-23::GFP + rol-6]. Maintain at 20 degrees.
|
|
| SD939 |
C. elegans |
mpk-1(ga111) unc-79(e1068) III. Show Description
Unc. Temperature-sensitive sterile. Maintain at 15C. NOTE: Lackenr & Kim (1998) incorrectly states that the ga111 mutant has a T to C transition. The transition is actually T to G giving rise to a Val148Gly substitution. Reference: Lackner MR & Kim SK. Genetics. 1998 Sep;150(1):103-17.
|
|
| SHG1675 |
C. elegans |
ego-1(ust351[GFP::ego-1]) I. Show Description
GFP inserted into endogenous ego-1 locus using CRISPR/CAS9 engineering. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
| SHG665 |
C. elegans |
erh-2(ust640[erh-2::GFP::3xFlag]) III. Show Description
GFP::3xFlag inserted into endogenous erh-2 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG682 |
C. elegans |
ife-3(ust639[ife-3::GFP::3xFlag]) V. Show Description
GFP::3xFlag inserted into endogenous ife-3 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHG753 |
C. elegans N2 |
Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate sterile ustIn1[pqn-85(ust85);best-4; t10d4.6] animals, and non-GFP W07E6.2(ust90) homozygotes which is larval arrested .
|
|
| SHG763 |
C. elegans |
prg-1(ust643[3xFlag::GFP::prg-1]) I. Show Description
3xFlag::GFP inserted into endogenous prg-1 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
|
|
| SHX324 |
C. elegans |
fzo-1(zju136[fzo-1::GFP]) II. Show Description
GFP tag inserted into endogenous fzo-1 locus via CRISPR/Cas9 engineering. Reference: Fu H, et al. Nat Commun. 2020 Feb 26;11(1):1050. PMID: 32103012.
|
|
| SJ17 |
C. elegans |
xbp-1(zc12) III; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. xbp-1(zc12) animals contain a nonsense mutation at residue 11 in the predicted xbp-1 protein. Animals are unable to induce hsp-4::GFP in response to treatment by tunicamycin or heat shock.
|
|
| SJ4001 |
C. elegans |
zcIs1. Show Description
zcIs1 [aip-1::GFP].
|
|
| SJ4003 |
C. elegans |
zcIs3 I. Show Description
zcIs3 [aip-1::GFP] I.
|
|
| SJ4063 |
C. elegans |
zcIs8 X. Show Description
zcIs8 contains [abu-1::GFP].
|
|
| SJ4151 |
C. elegans |
zcIs19. Show Description
zcIs19 contains [ubl-5p::ubl-5::GFP].
|
|
| SJ4157 |
C. elegans |
zcIs21 V. Show Description
zcIs21 contains [hsp-16p::clpp-1(WT)::3xmyc-His tag + myo-3p::GFP].
|
|
| SJ4197 |
C. elegans |
zcIs39 II. Show Description
zcIs39 contains [dve-1p::dve-1::GFP].
|
|
| SJ4199 |
C. elegans |
zcIs40 X. Show Description
zcIs40 [dve-1p::dve-1::3xmyc-His tag + myo-3p::GFP].
|
|
| SJ4200 |
C. elegans |
zcIs41 V. Show Description
zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].
|
|
| SJ4201 |
C. elegans |
zcIs42 X. Show Description
zcIs42 contains [ubl-5p::GFP].
|
|
| SJ4202 |
C. elegans |
zcIs22. Show Description
zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].
|
|
| SJ4203 |
C. elegans |
zcIs39 II; zcIs41 V. Show Description
zcIs39 contains [dve-1p::dve-1::GFP]. zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].
|
|
| SK4005 |
C. elegans |
zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons.
|
|
| SK4013 |
C. elegans |
zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.
|
|
| SL740 |
C. elegans |
dpy-2(e8) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.
|
|
| SLE1 |
Escherichia coli |
E. coli [argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rcn14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase]. Show Description
Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.
|
|
| SLP266 |
C. elegans |
sel-11(rem5) V. Show Description
Prolonged lethargus sleep duration. rem5 is an early stop mutation, likely null. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.
|
|
| SLP653 |
C. elegans |
sel-1(rem32) V. Show Description
Prolonged lethargus duration. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.
|
|
| SLR115 |
C. elegans |
dvIs67. Show Description
dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. Derived by out-crossing CL3462.
|
|
| SLR158 |
C. elegans |
pmk-3(tm745) IV; dvIs67; stxEx12. Show Description
dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. stxEx12 [eft-3p::pmk-3 S(EE)::SL2::mCherry]. Pick animals with mCherry expression in intestinal cells. Reference: Munkacsy E, et al. PLoS Genet. 2016 Jul 15;12(7):e1006133.
|
|
| SOZ0259 |
C. elegans |
Show Description
Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .
|
|
| SOZ0300 |
C.elegans |
drop-1/cyp-37A1(ssd9) Show Description
drop-1 a.k.a.- cyp-37A1. ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
|
|
| SOZ0471 |
C. elegans |
Show Description
Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa
|
|
| SOZ0511 |
C. elegans |
drop-8/emb-8(ssd89) Show Description
Class III supersized lipid droplet mutant. GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt
|
|
| SOZ259 |
C. elegans |
prx-10(ssd68) Show Description
Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .
|
|
| SOZ300 |
C.elegans |
cyp-37A1(ssd9) II. Show Description
ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.
|
|
| SOZ471 |
C. elegans |
sams-1(ssd206) X. Show Description
sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
|
|
| SOZ511 |
C. elegans |
emb-8(ssd89) III. Show Description
emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
|
|
| SP1372 |
C. elegans |
osm-3(mn357) IV. Show Description
Defective in FITC dye filling.
|
|
| SP1377 |
C. elegans |
dpy-11(e224) V; lin-2(e1309) unc-7(mn384) xol-1(mn467) X. Show Description
Animals are DpyUncVul. Can mate at low frequency. N2 males X SP1377 fail to give male progeny. Weak unc-7 allele when not in lin-2 background.
|
|
| SP1405 |
C. elegans |
che-11(mn387) V. Show Description
Dye-filling mutant.
|
|
| SP1409 |
C. elegans |
che-11(mn393) V. Show Description
Dye-filling mutant.
|
|
| SP1414 |
C. elegans |
che-12(mn399) V. Show Description
Dye-filling mutant.
|
|
| SP1416 |
C. elegans |
che-11(mn404) V. Show Description
Dye-filling mutant.
|
|
| SP1444 |
C. elegans |
che-10(mn403) II. Show Description
Dye-filling defective. Reference: Starich TA, et al. 1995 Genetics 193:171-88
|
|
| SP1540 |
C. elegans |
mnDf111/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and UncVul.
|
|