More Fields
Strain Species Genotype
YEW1 Oscheius carolinensis Oscheius carolinensis. Show Description
Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.
YL139 C. elegans meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
YL140 C.elegans meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
YL243 C. elegans unc-119(ed3) III; vrIs79. Show Description
vrIs79 [pie-1p::GFP::prg-1 + unc-119(+)]. Transgene expresses GFP::PRG-1 protein fusion. Weak GFP expression prone to silencing. Maintain stocks at 25C to retain GFP expression. Reference: Wang G, Reinke V. Curr Biol. 2008 Jun 24;18(12):861-7.
YL390 C. elegans unc-119(ed3) III; vrIs48. Show Description
vrIs48 [pie-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
YL398 C. elegans unc-119(ed3) III; vrIs55. Show Description
vrIs55 [ges-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YL402 C. elegans unc-119(ed3) III; vrIs56. Show Description
vrIs56 [pie-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YL409 C. elegans unc-119(ed3) III; vrIs60. Show Description
vrIs60 [lin-35p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YL416 C. elegans unc-119(ed3) III; vrIs64. Show Description
vrIs64 [ges-1p::hpl-2::GFP::FLAG::hpl-2 3'UTR + unc-119(+)].
YL418 C. elegans unc-119(ed3) III; vrIs65. Show Description
vrIs65 [ges-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
YL424 C. elegans unc-119(ed3) III; vrIs68. Show Description
vrIs68 [efl-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
YL425 C. elegans unc-119(ed3) III; vrIs69. Show Description
vrIs69 [dpl-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
YL445 C. elegans unc-119(ed3) III; vrIs81. Show Description
vrIs81 [pie-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
YL448 C. elegans unc-119(ed3) III; vrIs83. Show Description
vrIs83 [ges-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
YL468 C. elegans unc-119(ed3) III; vrIs93. Show Description
vrIs93 [mex-5p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YQ95 C. elegans unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
YS2 C. elegans cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
YS4 C. elegans cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
YW16 C. elegans ced-12(tp2) I. Show Description
Persisting cell corpses. Distal tip cell migration defective.
YY11 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
YY1325 C. elegans wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY1446 C. elegans znfx-1(gg634[HA::tagRFP::znfx-1]) II. Show Description
HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY1492 C. elegans mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY156 C. elegans nrde-2(gg95) II. Show Description
Reference: Guang S, et al. Nature. 2010 Jun 24;465(7301):1097-101.
YY158 C. elegans nrde-3(gg66) X. Show Description
Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).
YY166 C. elegans ergo-1(gg98) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY168 C. elegans ergo-1(gg100) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY169 C. elegans ergo-1(gg102) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY186 C. elegans nrde-2(gg91) II. Show Description
T to A substitution at position 129 and Y to stop at position 24 in exon 2. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
YY216 C. elegans eri-9(gg106) III. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
YY238 C. elegans nrde-3(gg64) X. Show Description
Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).
YY453 C. elegans nrde-4(gg129) IV. Show Description
Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
YY470 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
YY538 C. elegans hrde-1(tm1200) III. Show Description
Maintain at 15C. Heritable RNAi defective, germline mortality (Mrt) at 25C. Reference: Buckley BA, et al. Nature. 2012 Sep 20;489(7416):447-51.
YY968 C. elegans znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV. Show Description
3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY996 C. elegans znfx-1(gg561) II. Show Description
Heritable RNAi defective, germline immortality. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
ZB1098 C. elegans glt-4(bz69) II. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB1099 C. elegans glt-5(bz70) II. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB1102 C. elegans glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Mano & Driscoll (2009) J Neurochem 108(6):1373-84.
ZB1106 C. elegans glt-3(bz34) IV; glt-1(ok206) X. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB1108 C. elegans bzEx?. Show Description
bzEx? [glt-3::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB1110 C. elegans bzEx?. Show Description
bzEx? [glt-4::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
ZB2844 C. elegans hpa-1(tm3256) IV. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.
ZB2845 C. elegans hpa-2(tm3827) II. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.
ZD101 C. elegans tir-1(qd4) III. Show Description
Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.
ZD193 C. elegans sek-1(km4) X; qdEx4. Show Description
qdEx4 [ges-1p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in the intestine. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
ZD202 C. elegans sek-1(km4) X; qdEx8. Show Description
qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
ZD39 C. elegans agIs219 III; pmk-1(km25) IV. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Intestinal GFP expression from agIs219 is abolished by km25. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
ZD500 C. elegans hecw-1(ok1347) III. Show Description
Pathogen avoidance phenotype. Defective nose touch response.
ZE1 C. elegans F53B2.5(ok226) Show Description
Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.