| UL1692 |
C. elegans |
unc-119(ed3) III; leEx1692. Show Description
leEx1692 contains [hlh-34::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
|
|
| UL2992 |
C. elegans |
leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL2994 |
C. elegans |
leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL2996 |
C. elegans |
leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL3294 |
C. elegans |
leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL3295 |
C. elegans |
leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL3351 |
C. elegans |
leEx3351. Show Description
leEx3351 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
|
|
| UL4239 |
C. elegans |
unc-68(le4239) V. Show Description
The UNC-68a R169C missense mutation (le4239) corresponds to a human myopathic variant, RyR1:p.R163C. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
|
|
| UL4285 |
C. elegans |
unc-68(le4285) V. Show Description
The UNC-68a N2441S missense mutation (le4285) corresponds to a human myopathic variant, RyR1:p.N2342S. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
|
|
| UN1502 |
C. elegans |
xbIs1502. Show Description
xbIs1502 [act-1::GFP + rol-6(su1006)]. GFP-labeled actin in the spermatheca. Reference: Wirshing ACE &, Cram EJ. Mol Biol Cell. 2017 Jul 7;28(14):1937-1949. doi: 10.1091/mbc.E17-01-0029. PMID: 28331075
|
|
| UP1135 |
C. elegans |
csEx52. Show Description
csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.
|
|
| UP1136 |
C. elegans |
csEx53. Show Description
csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.
|
|
| UP1226 |
C. elegans |
csEx72. Show Description
csEx72[hsp::lin-45ED + sur-5::GFP]. Maintain by picking GFP+.
|
|
| UP3666 |
C. elegans |
lpr-3(cs250[ssSfGFP::lpr-3]) X?. Show Description
Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
|
|
| UP3746 |
C. elegans |
let-653(cs262[let-653::SfGFP]) IV. Show Description
Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
|
|
| UP3756 |
C. elegans |
let-4(cs265[ssmCherry::let-4]) X. Show Description
Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
|
|
| UP4013 |
C. elegans |
bli-4(cs281) I; csEx919. Show Description
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| UR109 |
C. elegans |
cwp-4(tm727) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Portman Mod & Mech (2010).
|
|
| UR110 |
C. elegans |
cwp-2&cwp-3(ok1366) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Prtman Mod & Mech (2010).
|
|
| UR116 |
C. elegans |
him-5(e1490) V; cwp-5(tm1893) X. Show Description
Him strain. Superficially wild-type. Males have mating (response) defect but are fertile; otherwise superficially wild-type. Reference: Miller and Prtman Mod & Mech (2010).
|
|
| UT1 |
C. elegans |
lrn-1(mm93). Show Description
Associative learning deficient in several assays: Ion/E. coli appetitive conditioning, Ion/garlic aversive conditioning, Ion/Copper aversive conditioning, Diacetyl/acetic acid aversive conditioning. Sensorimotor normal. Non-associative learning with ions and diacetyl normal. No linkage group info available yet.
|
|
| UT2 |
C. elegans |
lrn-2(mm99). Show Description
Associative learning deficient in several assays: Ion/E. coli appetitive conditioning, Ion/garlic aversive conditioning, Ion/Copper aversive conditioning, Diacetyl/acetic acid aversive conditioning. Sensorimotor normal. Non-associative learning with ions and diacetyl normal. No linkage group info available yet.
|
|
| UTK1 |
C. elegans |
utkIs1. Show Description
utkIs1 [mbr-1p::GFP + rol-6(su1006)]. Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
|
|
| UTK11 |
C. elegans |
soc-1(n1789) V; mbr-1(qa5901) X; utkEx6. Show Description
utkEx6 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK12 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X: utkEx7. Show Description
utkEx7 [mbr-1p::GFP + cwn-1p(1.4kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK13 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx8. Show Description
utkEx8 [mbr-1p::GFP + cwn-1p(0.7kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK14 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx9. Show Description
utkEx9 [mbr-1p::GFP + cwn-1p(170bp)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK15 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx10. Show Description
utkEx10 [mbr-1p::GFP + cwn-2p(4.0kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK16 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx11. Show Description
utkEx11 [mbr-1p::GFP + cwn-2p(2.1kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK17 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx12. Show Description
utkEx12 [mbr-1p::GFP + cwn-2p(0.8kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK18 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx13. Show Description
utkEx13 [mbr-1p::GFP + H20::cwn-1 + H20::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK19 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx14. Show Description
utkEx14 [mbr-1p::GFP + cwn-1p(1.8kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK2 |
C. elegans |
mbr-1(qa5901) X. Show Description
Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
|
|
| UTK20 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx15. Show Description
utkEx15 [mbr-1p::GFP + cwn-1p(5.8kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK3 |
C. elegans |
cam-1(ak37) II; mbr-1(qa5901) X; utkEx2. Show Description
utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK8 |
C. elegans |
cam-1(gm122) cwn-1(ok546) II; mbr-1(qa5901) X; utkEx3. Show Description
utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK9 |
C. elegans |
cam-1(gm122) II; cwn-2(ok895) IV; mbr-1(qa5901) X;utkEx4. Show Description
utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTX113 |
C. elegans |
par-3(djd33[mScarlet-I-GLO::Myc::par-3]) III. Show Description
mScarlet-I-GLO and Myc tags inserted into endogenous par-3 locus. mScarlet-I-GLO is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Chang Y & Dickinson DJ. Cell Rep. 2022 Apr 12;39(2):110652. doi: 10.1016/j.celrep.2022.110652. PMID: 35417695.
|
|
| UU16 |
C. elegans |
pqIs2. Show Description
pqIs2 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 14: all four ALP-1 isoforms will be expressed but only ALP-1a will be tagged with GFP. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.
|
|
| UU17 |
C. elegans |
pqIs3. Show Description
pqIs3 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 18: all four ALP-1 isoforms will be expressed but only ALP-1b, ALP-1c, and ALP-1d will be tagged with GFP. Isoforms ALP-1b, ALP-1c, and ALP-1d are collectively known as the Enigma isoforms or ALP-1bcd/Enigma::GFPs. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.
|
|
| UU18 |
C. elegans |
pqIs4. Show Description
pqIs4 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 18: all four ALP-1 isoforms will be expressed but only ALP-1b, ALP-1c, and ALP-1d will be tagged with GFP. Isoforms ALP-1b, ALP-1c, and ALP-1d are collectively known as the Enigma isoforms or ALP-1bcd/Enigma::GFPs. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.
|
|
| UV21 |
C. elegans |
him-19(jf6) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
|
|
| UV26 |
C. elegans |
him-19(tm3538) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
|
|
| UV7 |
C. elegans |
unc-119(ed3) III; jfIs2. Show Description
jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.
|
|
| UZ101 |
C. elegans |
pha-1(e2123) III; xtEx84. Show Description
xtEx84 [ftn-1p(DR1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
|
|
| UZ105 |
C. elegans |
pha-1(e2123) III; xtEx88. Show Description
xtEx88 [ftn-1p(DR2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
|
|
| UZ111 |
C. elegans |
pha-1(e2123) III; xtEx94. Show Description
xtEx94 [ftn-1p(DR3m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
|
|
| UZ275 |
C. elegans |
pha-1(e2123) III; xtEx257. Show Description
xtEx257 [ftn-1p(DR123m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
|
|
| UZ495 |
C. elegans |
pha-1(e2123) III; xtEx448. Show Description
xtEx448 [ftn-1p(DR123ACm)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
|
|
| UZ73 |
C. elegans |
pha-1(e2123) III; xtEx61. Show Description
xtEx61 [ftn-1p(G1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
|
|