More Fields
Strain Species Genotype
VM133 C. elegans lin-15B&lin-15A(n765) X; akEx31. Show Description
akEx31 [glr-5::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
VM141 C. elegans lin-15B&lin-15A(n765) X; akEx32. Show Description
akEx32 [glr-4::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
VM143 C. elegans lin-15B&lin-15A(n765) X; akEx34. Show Description
akEx34 [glr-6::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
VM149 C. elegans lin-15B&lin-15A(n765) X; akEx38. Show Description
akEx38 [(pDM46) glr-7::GFP + (pJM23) lin-15(+)]. Worms with the array are non-Muv at 20C.
VM182 C. elegans lin-15B&lin-15A(n765) X; akEx51. Show Description
akEx51 [glr-2::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
VM314 C. elegans lin-15B&lin-15A(n765) X; akEx74. Show Description
akEx74 [nmr-2::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
VM396 C. elegans ocr-2(ak47) IV. Show Description
Chemosensory, mechanosensory, and osmosensory defects. Null allele.
VM4721 C. elegans sol-1(ak63) Show Description
Nose touch defective. Slowed response to hyperosmotic solutions. Glutamate-gated current mediated by non-NMDA type receptors decreased in the AVA and AVD interneurons.
VM484 C. elegans akIs3 V. Show Description
akIs3 [nmr-1::GFP + lin-15(+)] V.
VM487 C. elegans nmr-1(ak4) II. Show Description
Fewer spontaneous reversals. Required for NMDA gated currents.
VM57 C. elegans lin-15B&lin-15A(n765) X; akEx16. Show Description
akEx16 [glr-3::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
VM763 C. elegans lin-15B&lin-15A(n765) X; akEx130. Show Description
akEx130 [(pPB45) glr-1::GFP + (pJM23) lin-15(+)]. Worms with the array are non-Muv at 20C.
VP198 C. elegans kbIs5. Show Description
kbIs5 [gpdh-1p::GFP + rol-6(su1006)]. Rollers, though not obvious in all animals. Maintain under normal conditions. GFP expressed intestine and hypodermis only during hypertonic stress; not induced by other stressers. Reference: Lamitina T, et al. Proc Natl Acad Sci USA. 2006 Aug 8;103(32):12173-8.
VP303 C. elegans rde-1(ne219) V; kbIs7. Show Description
kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.
VP596 C. elegans dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
VPR127 C. elegans vprIs127. Show Description
vprIs127 [hlh-17p::GFP]. Unc, backward ventral coiler.
VPR157 C. elegans vprIs157. Show Description
vprIs157 [hlh-17p::GFP]. Unc, backward ventral coiler.
VPR168 C. elegans wyEx915. Show Description
wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.
VPR839 C. elegans unc-119(ed4) III; irIs67. Show Description
irIs67 [hlh-17p::GFP + unc-119(+)].
VS10 C. elegans hjIs37. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. mRFP targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.
VS15 C. elegans hjIs8. Show Description
hjIs8 [ges-1p::GFP-PTS1]. GFP targeted to peroxisomes in intestinal cells.
VS17 C. elegans hjIs9. Show Description
hjIs9 [ges-1p::glo-1::GFP + unc-119(+)]. GFP targeted to lysosome related organelles (LROs) in intestinal cells. Reference: Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS18 C. elegans maoc-1(hj13) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS19 C. elegans maoc-1(hj14) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS20 C. elegans hjIs67. Show Description
hjIs67 [atgl-1p::atgl-1::GFP + mec-7::RFP]. GFP expression is not detectable at low magnification. Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS21 C. elegans hjSi20 IV. Show Description
hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.
VS24 C. elegans kat-1(tm1037) II. Show Description
Reference: Nat Genet. 2006 Mar;38(3):363-8.
VS25 C. elegans hjIs14. Show Description
hjIs14 [vha-6p::GFP::C34B2.10(SP12) + unc-119(+)]. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
VS26 C. elegans rde-10(hj20) I. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
VS27 C. elegans rde-11(hj37) IV. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
VS29 C. elegans hjSi56 IV. Show Description
hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
VS30 C. elegans hjSi158 I. Show Description
hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.
VS8 C. elegans dhs-28(hj8) X. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VT1072 C. elegans unc-119(ed3) III; maIs134. Show Description
maIs134 [lin-4p::GFP + unc-119(+)]. Wild type.
VT1113 C. elegans unc-119(ed3) III; maIs135. Show Description
maIs135 [mir-237p::GFP + unc-119(+)]. Wild type.
VT1153 C. elegans unc-119(ed3) III; maIs137. Show Description
maIs137 [let-7p::GFP + unc-119(+)]. Wild type.
VT1160 C. elegans unc-119(ed3) III; maIs138. Show Description
maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.
VT1189 C. elegans unc-119(ed3) III; maIs140. Show Description
maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.
VT1259 C. elegans unc-119(ed3) III; maIs150. Show Description
maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.
VT1289 C. elegans mir-63(n4568) X. Show Description
Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1343 C. elegans flh-1(bc374) IV. Show Description
VT1361 C. elegans mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1362 C. elegans mir-70(n4109) V. Show Description
Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1376 C. elegans flh-2(bc375) III. Show Description
VT1379 C. elegans unc-119(ed3) III; maIs162. Show Description
maIs162 [mir-59p::GFP + unc-119(+)]. Wild type.
VT1380 C. elegans unc-119(ed3) III; maIs163. Show Description
maIs163 [mir-357-358p::GFP + unc-119(+)]. Wild type. [10/01/2018: Received new stock from VT following report from user that GFP expression pattern in original stock was not as expected.]
VT1470 C. elegans unc-119(ed3) III; maIs173. Show Description
maIs173 [mir-242p::GFP + unc-119(+)]. Wild type.
VT1474 C. elegans unc-119(ed3) III; maIs177. Show Description
maIs177 [mir-243p::GFP + unc-119(+)]. Wild type.
VT1477 C. elegans unc-119(ed3) III; maIs180. Show Description
maIs180 [mir-244p::GFP + unc-119(+)]. Wild type.
VT1479 C. elegans unc-119(ed3) III; maIs182. Show Description
maIs182 [mir-251p::GFP + unc-119(+)]. Wild type.