Search Strains

nsIs700 [nep-2(prom7)::tagRFP]. RFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.

nsIs746 [nep-2(prom7)::GFP]. GFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.

nsIs758 [nep-2(prom7)::2xNLS::YFP]. Nuclear YFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.

nsEx37 [cfi-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Shaham S, Bargmann CI. Genes Dev. 2002 Apr 15;16(8):972-83.

Endogenous dmd-4 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Stefanakis N, et al. Development. 2025 Jul 15;152(14):dev204622. doi: 10.1242/dev.204622. PMID: 40728647.

Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.

zyIs1 [lin-11::RFP + rol-6(su1006)]. Roller. Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.

cyIs4 [cat-1::GFP + rol-6(su1006)]. Reference: Habibi-Babadi N, et al. J Neurosci. 2010 Feb 3;30(5):1766-76.

Homozygous viable. Reference: Sin O, et al. Mol Cell. 2017 Mar 16;65(6):1096-1108.

pkIs2386 [unc-54p::alpha-synuclein::YFP + unc-119(+)].

pkIs2386 [unc-54p::alpha-synuclein::YFP + unc-119(+)].

dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16C to minimize selection against transgene. [NOTE: Out-crossing has eliminated embryonic lethality seen in parental strain CL6049 when raised at 25C.] Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Parental strain CL6049 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.

dvIs15 [unc-54(vector) + mtl-2::GFP]. Control strain for OW1601. Phenotype apparently Wild-type. Parental strain CL2122 out-crossed 6x to N2. Reference: Koopman M, et al. MicroPubl Biol. 2023 Apr 19:2023:10.17912/micropub.biology.000766. doi: 10.17912/micropub.biology.000766. eCollection 2023. PMID: 37151213.

Homozygous viable. Reference: van Ham TJ, et al. Cell. 2010 Aug 20;142(4):601-12.

C15H9.7. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

D2024.2. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

R07B7.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

K06A4.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.

Crispr/Cas9 engineered deletion mutant removes 28 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.

Crispr/Cas9 engineered deletion mutant removes 14 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.

Crispr/Cas9 engineered deletion mutant removes 9 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.

Unc. According to Withee (2004), gm104 has been sequenced and introduces an early amber stop at W24. Reference: Withee J, et al. Genetics. 2004 Jul;167(3):1165-76. PMID: 15280232

Unc-lethargic and kinker. Throws abnormal males-fused rays 4 and 6.

Chubby (short and fat--analogous to C. elegans Dpy phenotype). Parental strain is Caenorhabditis briggsae G16. Males are chubby, therefore cby-3 is X-linked.

stIs20120 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Him. Reference: Ragavapuram V, et al. G3 (Bethesda). 2015 Dec 31.

Type A Egl. Males abnormal-fused rays. See also WBPaper00002235.

Male-female strain. Parental strain is C. remanei ssp. vulgaris. Males and females back poorly, forward movement unaffected. Males are able to mate. Autosomal. Based on phenotype alone (defective in backward movement), it might be orthologous to unc-4. See WBPaper00002633.

Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.

Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.

Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Cox Arboretum, Dayton Ohio. Species ID confirmed by mating test with EM464.

Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.

Male-female strain. From association with a terrestrial isopod, Armadillidium vulgare, that was collected from Eastwood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.

Male-female strain. From association with a terrestrial isopod, Cylisticus convexus, that was collected from Englewood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.

Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Ward's Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.

Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Connecticut Valley Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.

ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.

Endogenous lin-14 locus tagged with GFP. Reference: Arribere JA et al. Genetics. 2014 Nov;198(3):837-46.

Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23.

Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1.

arIs39 [myo-3p::ssGFP + dpy-20(+)].

ccEx3163 [unc-39p::unc-39 gene (genomic fragment)::GFP::unc-39 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. ccEx3163 carries unc-39 construct pJLY99.1.

Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.

ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.

mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. Superficially wild-type. GFP expression in 4-cell embryos, pharyngeal muscle and gut. GFP signal is dim but visible under dissecting scope. See WBG 15 #5 page 20.

mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.

mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. See WBG 15 #5 page 20.

Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]

Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]

Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.