wwEx54 [acdh-1p::GFP]. Maintain by picking GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwIs23 [nhr-178p::GFP + unc-119(+)]. Decreased GFP expression in the pharynx; no detectable expression in Int1 cells. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwIs24 [acdh-1p::GFP + unc-119(+)]. May still be carrying unc-119(ed3) in the background. References: MacNeil LT, etr al. Cell. 2013 Mar 28;153(1):240-52. Watson E, et al. Cell. 2014 Feb 13;156(4):759-70.

wwIs23 [nhr-178p::GFP + unc-119(+)]. wwEx55 [nhr-45p::nhr-45(genomic)::nhr-45 3'utr + rol-6(su1006)]. Maintain by picking Rollers. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwEx51 contains [hlh-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

wwIs10 [mir-45p::GFP + unc-119(+)]. Wild type.

Temperature sensitive Dpy. Nose touch defective (Not). Osmotic avoidance defective (Osm). Required for rapid glutamate-gated currents in the AVA interneurons. Null Allele.

akEx29 [glr-8::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

akEx31 [glr-5::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

akEx32 [glr-4::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

akEx34 [glr-6::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

akEx38 [(pDM46) glr-7::GFP + (pJM23) lin-15(+)]. Worms with the array are non-Muv at 20C.

akEx51 [glr-2::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

akEx74 [nmr-2::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

Chemosensory, mechanosensory, and osmosensory defects. Null allele.

Nose touch defective. Slowed response to hyperosmotic solutions. Glutamate-gated current mediated by non-NMDA type receptors decreased in the AVA and AVD interneurons.

akIs3 [nmr-1::GFP + lin-15(+)] V.

Fewer spontaneous reversals. Required for NMDA gated currents.

akEx16 [glr-3::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.

akEx130 [(pPB45) glr-1::GFP + (pJM23) lin-15(+)]. Worms with the array are non-Muv at 20C.

kbIs5 [gpdh-1p::GFP + rol-6(su1006)]. Rollers, though not obvious in all animals. Maintain under normal conditions. GFP expressed intestine and hypodermis only during hypertonic stress; not induced by other stressers. Reference: Lamitina T, et al. Proc Natl Acad Sci USA. 2006 Aug 8;103(32):12173-8.

kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).

vprIs127 [hlh-17p::GFP]. Unc, backward ventral coiler.

vprIs157 [hlh-17p::GFP]. Unc, backward ventral coiler.

wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.

irIs67 [hlh-17p::GFP + unc-119(+)].

hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. mRFP targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.

hjIs8 [ges-1p::GFP-PTS1]. GFP targeted to peroxisomes in intestinal cells.

hjIs9 [ges-1p::glo-1::GFP + unc-119(+)]. GFP targeted to lysosome related organelles (LROs) in intestinal cells. Reference: Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

hjIs67 [atgl-1p::atgl-1::GFP + mec-7::RFP]. GFP expression is not detectable at low magnification. Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.

Reference: Nat Genet. 2006 Mar;38(3):363-8.

hjIs14 [vha-6p::GFP::C34B2.10(SP12) + unc-119(+)]. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.

RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.

RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.

hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.

hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.

Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

maIs134 [lin-4p::GFP + unc-119(+)]. Wild type.

maIs135 [mir-237p::GFP + unc-119(+)]. Wild type.

maIs137 [let-7p::GFP + unc-119(+)]. Wild type.

maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.

maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.

maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.

Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.