More Fields
Strain Species Genotype
UU17 C. elegans pqIs3. Show Description
pqIs3 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 18: all four ALP-1 isoforms will be expressed but only ALP-1b, ALP-1c, and ALP-1d will be tagged with GFP. Isoforms ALP-1b, ALP-1c, and ALP-1d are collectively known as the Enigma isoforms or ALP-1bcd/Enigma::GFPs. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.
UU18 C. elegans pqIs4. Show Description
pqIs4 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 18: all four ALP-1 isoforms will be expressed but only ALP-1b, ALP-1c, and ALP-1d will be tagged with GFP. Isoforms ALP-1b, ALP-1c, and ALP-1d are collectively known as the Enigma isoforms or ALP-1bcd/Enigma::GFPs. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.
UV21 C. elegans him-19(jf6) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
UV26 C. elegans him-19(tm3538) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
UV7 C. elegans unc-119(ed3) III; jfIs2. Show Description
jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.
UZ101 C. elegans pha-1(e2123) III; xtEx84. Show Description
xtEx84 [ftn-1p(DR1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ105 C. elegans pha-1(e2123) III; xtEx88. Show Description
xtEx88 [ftn-1p(DR2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ111 C. elegans pha-1(e2123) III; xtEx94. Show Description
xtEx94 [ftn-1p(DR3m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ275 C. elegans pha-1(e2123) III; xtEx257. Show Description
xtEx257 [ftn-1p(DR123m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ495 C. elegans pha-1(e2123) III; xtEx448. Show Description
xtEx448 [ftn-1p(DR123ACm)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ73 C. elegans pha-1(e2123) III; xtEx61. Show Description
xtEx61 [ftn-1p(G1m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ78 C. elegans pha-1(e2123) III; xtEx66. Show Description
xtEx66 [ftn-1p(G2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ88 C. elegans pha-1(e2123) III; xtEx72. Show Description
xtEx72 [ftn-1p(G12m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
UZ96 C. elegans pha-1(e2123) III; xtEx79. Show Description
xtEx79 [pes-10(+63)::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
VC30089 C. elegans Whole-genome sequenced strain. Show Description
Strain VC30089 should be named VC30126. Please use VC30126 when referring to the strain.
VC3478 C. elegans +/mT1 II; spcs-2(gk3387)/mT1[dpy-10(e128)] III. Show Description
Homozygous lethal or sterile deletion balanced by translocation marked with dpy-10(e128). Heterozygotes are fertile WT and segregate fertile WT, gk3387 homozygotes (sterile adults that tend to explode at vulva), dead eggs (aneuploids) and sterile Dpy-10 mT1 homozygotes. Pick fertile WT to maintain. Reasonably well balanced but not perfect.
VC3680 C. elegans T23B12.11(gk3652) V; igcm-2(gk3654) X. Show Description
Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.
VC3681 C. elegans C06A6.5(gk3655) IV. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.
VC3787 C. elegans ZK673.2(gk3749) II; gop-1(gk3747) III. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3788 C. elegans ZK673.2(gk3749) II; lipl-5(gk3748) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3790 C. elegans F47D12.6(gk3750) III; ptr-16(gk3752) V; M163.11(gk3751) X. Show Description
Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.
VC3792 C. elegans sop-3(gk3753) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3875 C. elegans clc-1(gk3754) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3876 C. elegans C33F10.8(gk3755) II; F28C1.1(gk3756) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing.
VC3877 C. elegans F28C6.4(gk3758) F13D12.3(gk3757) II; Y55F3AM.9(gk3760) M7.8(gk3759) IV. Show Description
Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.
VC3878 C. elegans F58H1.6(gk3761) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3879 C. elegans pyk-1(gk3762) I; Y38H8A.12(gk3763) IV; ZC8.6(gk3764) X. Show Description
Homozygous viable. Splicing defects identified by amplicon sequencing.
VC3880 C. elegans C51E3.9(gk3766) C27A7.9(gk3765) V. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC3881 C. elegans str-211(gk3767) I. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.
VC3942 C. elegans col-128(gk5030) IV. Show Description
Homozygous viable. Splicing defect identified by amplicon sequencing.
VC3945 C. elegans F12A10.8(gk5033) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC3964 C. elegans aps-3(gk5047) I; C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC3965 C. elegans clec-118(gk5049) C17C3.3(gk5048) II. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC4001 C. elegans Y55F3AM.11(gk5073) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.
VC4002 C. elegans C06E2.9(gk5074) C05G5.3(gk5075) X. Show Description
Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.
VC4083 C. elegans tni-4(gk5170) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT.
VC4084 C. elegans T27E7.4(gk5171) IV; irk-2(gk5172) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.
VC4085 C. elegans glb-31(gk5173) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.
VC4086 C. elegans Y37H9A.1(gk5174) .I Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.
VC4087 C. elegans Y45F10D.15(gk5175) IV. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5175 mutation is C->T, flanking sequences TCAATCCGCAAAAAGATGCAGAGAAGGTAA and TGAAAAATTGTGTAGGTAAGAAAAAAAAAA.
VC4088 C. elegans gpa-14(gk5176) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT.
VC4089 C. elegans C27A7.6(gk5177) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5177 mutation is C->T, flanking sequences TGTTATACAATTAAATTTAAAAAATCCTTA and CGAGACATCCACAAAGAGTGTAAACGATTA.
VC4090 C. elegans hot-8(gk5178) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5178 mutation is G->A, flanking sequences GCAGAAACATAGAAACTTTGAAATTTTTCA and ATACCTCATGTAGTCGAATGCCTGCACATA.
VC4091 C. elegans F16A11.1(gk5179) I; H23N18.4(gk5180) K11G9.2(gk5181) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5179 mutation is C->T, flanking sequences GGTGAAGCTGAGGCATTACGCGCTTCTCGT and TGAAAAATTTTAATGGATTTTTTGATTCTT. The gk5180 mutation is G->A, flanking sequences AAACTGAAAAGAAGACGTTTCCAATGCTTT and GGATTCTCAACTTATGAATAATCCGATATT. The gk5181 mutation is T->A, flanking sequences AGCATTTGCAGACGGAGATTTTACAACTTG and GAAGAAAATTTTAAAAGACGAGTTGAATCC.
VC4092 C. elegans etc-1(gk5182) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.
VC4093 C. elegans K11E4.1(gk5184) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5184 mutation is G->A, flanking sequences CCGACTTGCTGACTGCATTCGGAAGACTAT and GAATAGTGGCCTCGGCGCTTATATGAAACA.
VC4094 C. elegans col-141(gk5185) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.
VC4095 C. elegans srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.
VC4112 C. elegans T03F6.10(gk5189) III. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.
VC4113 C. elegans K12C11.6(gk5190) I; sre-40(gk5191) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.