More Fields
Strain Species Genotype
TY567 C. elegans +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf2/szT1 X. Show Description
Unc. Throws Unc, UncLon males and dead eggs.
TY578 C. elegans +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf5/szT1 X. Show Description
Unc. Throws Unc, UncLon males and dead eggs.
TY832 C. elegans yDf4/dpy-11(e224) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
TY873 C. elegans yDf6/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc, and dead eggs. Maintain by picking WT.
TY903 C. elegans yDf7/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and dead eggs. Maintain by picking WT.
TY956 C. elegans sdc-3(y132)/unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.
UA2 C. elegans baEx2. Show Description
baEx2 [lis-1::GFP + rol-6(su1006)]. Maintain by picking Rollers.
UA47 C. elegans baIs13. Show Description
baIs13 [nud-1::GFP + rol-6(su1006)]. Rollers.
UDN100028 C. elegans rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at 20 degrees. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
UDN100035 C. elegans rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100103 C. elegans rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100154 C. elegans vps-34(udn80) I. Show Description
vps-34 [Y752C] #2. StyI restriction site created by synonymous changes, ease for genotyping. vps-34 [Y752C] are wild-type for the following phenotypes: Length, Width, Body wavelength, Crawl speed, Thrash rate, Pharyngeal Pump frequency, duration, R/E ratio, Germ cell corpse engulfment, coelomocyte endocytosis, coelomocyte size, gut vesicle size, and RAB-7(+) gut vesicle size.
UDN100156 C. elegans vps-34(udn82) I. Show Description
vps-34 [Y752Y] #1. Control edit for vps-34(udn80). StyI restriction site created by synonymous changes for ease for genotyping.
UDN100169 C. elegans unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer.
UDN100201 C. elegans jsSi1579 jsSi1606 II. Show Description
jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).
UF64 C. elegans gqIs37 II; oxIs12 X. Show Description
gqIs37 [unc-47::ppk-1 + myo-2::GFP] II. oxIs12 [unc-47p::GFP + lin-15(+)].
UF65 C. elegans muIs32 II; gqIs25. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. gqIs25 [rab-3p::ppk-1 + lin-15(+)].
UH1 C. briggsae Show Description
Isolated from the soil in a kabocha pumpkin patch garden (Baermann funnel method) in Kurtistown (native Hawaiian place name: Ola'a), Hawaii Island, on June 24, 2008.
UL1435 C. elegans unc-119(ed3) III; leEx1435. Show Description
leEx1435 contains [hnd-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1531 C. elegans unc-119(ed3) III; leEx1531. Show Description
leEx1531 contains [mml-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1533 C. elegans unc-119(ed3) III; leEx1533. Show Description
leEx1533 contains [hlh-3::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1556 C. elegans unc-119(ed3) III; leEx1556. Show Description
leEx1556 contains [hlh-12::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1583 C. elegans unc-119(ed3) III; leEx1583. Show Description
leEx1583 contains [hlh-4::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1601 C. elegans unc-119(ed3) III; leEx1601. Show Description
leEx1601 contains [hlh-8::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1606 C. elegans unc-119(ed3) III; leEx1606. Show Description
leEx1606 contains [aha-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL1692 C. elegans unc-119(ed3) III; leEx1692. Show Description
leEx1692 contains [hlh-34::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.
UL2992 C. elegans leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2994 C. elegans leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2996 C. elegans leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3294 C. elegans leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3295 C. elegans leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3351 C. elegans leEx3351. Show Description
leEx3351 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL4239 C. elegans unc-68(le4239) V. Show Description
The UNC-68a R169C missense mutation (le4239) corresponds to a human myopathic variant, RyR1:p.R163C. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
UL4285 C. elegans unc-68(le4285) V. Show Description
The UNC-68a N2441S missense mutation (le4285) corresponds to a human myopathic variant, RyR1:p.N2342S. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
UN1502 C. elegans xbIs1502. Show Description
xbIs1502 [act-1::GFP + rol-6(su1006)]. GFP-labeled actin in the spermatheca. Reference: Wirshing ACE &, Cram EJ. Mol Biol Cell. 2017 Jul 7;28(14):1937-1949. doi: 10.1091/mbc.E17-01-0029. PMID: 28331075
UP1135 C. elegans csEx52. Show Description
csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.
UP1136 C. elegans csEx53. Show Description
csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.
UP1226 C. elegans csEx72. Show Description
csEx72[hsp::lin-45ED + sur-5::GFP]. Maintain by picking GFP+.
UP3666 C. elegans lpr-3(cs250[ssSfGFP::lpr-3]) X?. Show Description
Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3746 C. elegans let-653(cs262[let-653::SfGFP]) IV. Show Description
Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3756 C. elegans let-4(cs265[ssmCherry::let-4]) X. Show Description
Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP4013 C. elegans bli-4(cs281) I; csEx919. Show Description
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
UR109 C. elegans cwp-4(tm727) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Portman Mod & Mech (2010).
UR110 C. elegans cwp-2&cwp-3(ok1366) him-5(e1490) V. Show Description
Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Prtman Mod & Mech (2010).
UR116 C. elegans him-5(e1490) V; cwp-5(tm1893) X. Show Description
Him strain. Superficially wild-type. Males have mating (response) defect but are fertile; otherwise superficially wild-type. Reference: Miller and Prtman Mod & Mech (2010).
UT1 C. elegans lrn-1(mm93). Show Description
Associative learning deficient in several assays: Ion/E. coli appetitive conditioning, Ion/garlic aversive conditioning, Ion/Copper aversive conditioning, Diacetyl/acetic acid aversive conditioning. Sensorimotor normal. Non-associative learning with ions and diacetyl normal. No linkage group info available yet.
UT2 C. elegans lrn-2(mm99). Show Description
Associative learning deficient in several assays: Ion/E. coli appetitive conditioning, Ion/garlic aversive conditioning, Ion/Copper aversive conditioning, Diacetyl/acetic acid aversive conditioning. Sensorimotor normal. Non-associative learning with ions and diacetyl normal. No linkage group info available yet.
UTK1 C. elegans utkIs1. Show Description
utkIs1 [mbr-1p::GFP + rol-6(su1006)]. Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
UTK11 C. elegans soc-1(n1789) V; mbr-1(qa5901) X; utkEx6. Show Description
utkEx6 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
UTK12 C. elegans cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X: utkEx7. Show Description
utkEx7 [mbr-1p::GFP + cwn-1p(1.4kb)::cwn-1 + rol-6(su1006)]. Rollers.