YEW1 |
Oscheius carolinensis |
Oscheius carolinensis. Show Description
Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.
|
|
YL139 |
C. elegans |
meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
YL140 |
C.elegans |
meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
YL243 |
C. elegans |
unc-119(ed3) III; vrIs79. Show Description
vrIs79 [pie-1p::GFP::prg-1 + unc-119(+)]. Transgene expresses GFP::PRG-1 protein fusion. Weak GFP expression prone to silencing. Maintain stocks at 25C to retain GFP expression. Reference: Wang G, Reinke V. Curr Biol. 2008 Jun 24;18(12):861-7.
|
|
YL390 |
C. elegans |
unc-119(ed3) III; vrIs48. Show Description
vrIs48 [pie-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
YL398 |
C. elegans |
unc-119(ed3) III; vrIs55. Show Description
vrIs55 [ges-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YL402 |
C. elegans |
unc-119(ed3) III; vrIs56. Show Description
vrIs56 [pie-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YL409 |
C. elegans |
unc-119(ed3) III; vrIs60. Show Description
vrIs60 [lin-35p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YL416 |
C. elegans |
unc-119(ed3) III; vrIs64. Show Description
vrIs64 [ges-1p::hpl-2::GFP::FLAG::hpl-2 3'UTR + unc-119(+)].
|
|
YL418 |
C. elegans |
unc-119(ed3) III; vrIs65. Show Description
vrIs65 [ges-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
YL424 |
C. elegans |
unc-119(ed3) III; vrIs68. Show Description
vrIs68 [efl-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
YL425 |
C. elegans |
unc-119(ed3) III; vrIs69. Show Description
vrIs69 [dpl-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
YL445 |
C. elegans |
unc-119(ed3) III; vrIs81. Show Description
vrIs81 [pie-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
YL448 |
C. elegans |
unc-119(ed3) III; vrIs83. Show Description
vrIs83 [ges-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
YL468 |
C. elegans |
unc-119(ed3) III; vrIs93. Show Description
vrIs93 [mex-5p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YQ95 |
C. elegans |
unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
|
|
YS2 |
C. elegans |
cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
YS4 |
C. elegans |
cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
YW16 |
C. elegans |
ced-12(tp2) I. Show Description
Persisting cell corpses. Distal tip cell migration defective.
|
|
YY11 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
|
|
YY1325 |
C. elegans |
wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY1446 |
C. elegans |
znfx-1(gg634[HA::tagRFP::znfx-1]) II. Show Description
HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY1492 |
C. elegans |
mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY156 |
C. elegans |
nrde-2(gg95) II. Show Description
Reference: Guang S, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|
YY158 |
C. elegans |
nrde-3(gg66) X. Show Description
Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).
|
|
YY166 |
C. elegans |
ergo-1(gg98) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY168 |
C. elegans |
ergo-1(gg100) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY169 |
C. elegans |
ergo-1(gg102) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY186 |
C. elegans |
nrde-2(gg91) II. Show Description
T to A substitution at position 129 and Y to stop at position 24 in exon 2. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|
YY216 |
C. elegans |
eri-9(gg106) III. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY238 |
C. elegans |
nrde-3(gg64) X. Show Description
Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).
|
|
YY453 |
C. elegans |
nrde-4(gg129) IV. Show Description
Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
|
|
YY470 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
|
|
YY538 |
C. elegans |
hrde-1(tm1200) III. Show Description
Maintain at 15C. Heritable RNAi defective, germline mortality (Mrt) at 25C. Reference: Buckley BA, et al. Nature. 2012 Sep 20;489(7416):447-51.
|
|
YY968 |
C. elegans |
znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV. Show Description
3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY996 |
C. elegans |
znfx-1(gg561) II. Show Description
Heritable RNAi defective, germline immortality. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
ZB1098 |
C. elegans |
glt-4(bz69) II. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
ZB1099 |
C. elegans |
glt-5(bz70) II. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
ZB1102 |
C. elegans |
glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Mano & Driscoll (2009) J Neurochem 108(6):1373-84.
|
|
ZB1106 |
C. elegans |
glt-3(bz34) IV; glt-1(ok206) X. Show Description
Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
ZB1108 |
C. elegans |
bzEx?. Show Description
bzEx? [glt-3::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
ZB1110 |
C. elegans |
bzEx?. Show Description
bzEx? [glt-4::GFP + rol-6(su1006)]. Rollers. Maintain by picking rollers. Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
|
|
ZB2844 |
C. elegans |
hpa-1(tm3256) IV. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.
|
|
ZB2845 |
C. elegans |
hpa-2(tm3827) II. Show Description
Reference: Iwasa H, et al. Aging Cell. 2010 Aug;9(4):490-505.
|
|
ZD101 |
C. elegans |
tir-1(qd4) III. Show Description
Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.
|
|
ZD193 |
C. elegans |
sek-1(km4) X; qdEx4. Show Description
qdEx4 [ges-1p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in the intestine. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|
ZD202 |
C. elegans |
sek-1(km4) X; qdEx8. Show Description
qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|
ZD260 |
C. elegans |
sek-1(km4) X; qdEx11. Show Description
qdEx11 [osm-5p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in ciliated sensory neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|
ZD39 |
C. elegans |
agIs219 III; pmk-1(km25) IV. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Intestinal GFP expression from agIs219 is abolished by km25. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|
ZD500 |
C. elegans |
hecw-1(ok1347) III. Show Description
Pathogen avoidance phenotype. Defective nose touch response.
|
|