More Fields
Strain Species Genotype
STR536 C. elegans hrtEx161. Show Description
hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.
STR58 C. elegans hrtIs3. Show Description
hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. Myristylated GFP marker for PVD. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
STR66 C. elegans hrtSi4 I. Show Description
hrtSi4 [gcy-36p::ebp-2::gfp + unc-119(+)] I. hrtSi4 inserted into ttTi4348. EBP-2::GFP expression in PQR, URX and AQR. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
STR71 C. elegans hrtSi5 I. Show Description
hrtSi5 [des-2p::ebp-2::GFP + unc-119(+)] I. hrtSi5 inserted into ttTi4348. EBP-2::GFP expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
STR75 C. elegans hrtSi9 I. Show Description
hrtSi9 [ceh-10p::ebp-2::gfp + unc-119(+)] I. hrtSi9 inserted into ttTi4348. EBP-2::GFP expression in CAN. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
SU1085 C. elegans tes-1(jc110[mScarlet-1::FLAG::tes-1 + LoxP511]) IV. Show Description
mScarlet and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.
SU159 C. elegans ajm-1(ok160) X; jcEx44. Show Description
jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs.
SU265 C. elegans jcIs17. Show Description
jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.
SU295 C. elegans jcIs25. Show Description
jcIs25 [pPE103 (jac-1::GFP) + rol-6(su1006)]. Rollers. Reference: Pettitt et al. 2003. LCB 162:15-22.
SU351 C. elegans mig-5(rh94)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.
SU352 C. elegans mig-5(rh147)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.
SU896 C.elegans hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V. Show Description
mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663.
SU955 C. elegans tes-1(jc71[mNG::tes-1 + LoxP]) IV. Show Description
mNeonGreen and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.
SV1009 C. elegans heIs63 V. Show Description
heIs63 [wrt-2p::GFP::PH + wrt-2p::GFP::H2B + lin-48p::mCherry] V. GFP expression in seam cells and mCherry expression in pharynx. Reference: Wildwater M, et al. Development. 2011 Oct;138(20):4375-85.
SV1067 C. elegans unc-119(ed3) III; heSi45 IV. Show Description
heSi45 [mcm-4::mCherry + unc-119(+)] IV. This strain contains an S-phase marker that will express mCherry in all cells that undergo cell division, providing a useful alternative to BrdU and EdU staining that is suitable for live imaging. References: Korzelius J, et al. Dev Biol. 2011 Feb 15;350(2):358-69. Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362.
SV1619 C. elegans dhc-1(he250[mCherry::dhc-1]) I. Show Description
This strain carries endogenously tagged dynein heavy chain (mCherry::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038
SV1803 C. elegans dhc-1(he264[eGFP::dhc-1]) I. Show Description
This strain carries endogenously tagged dynein heavy chain (egfp::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038
SV2002 C. elegans rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. Show Description
eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
SV2114 C. elegans pop-1(he335[eGFP::loxP::pop-1]) I. Show Description
eGFP tag inserted into endogenous pop-1 locus. The homozygous gfp::pop-1 strain is viable, although not fully healthy and occasionally missing a seam cell. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
SWF117 C elegans flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF142 C elegans mod-1(ok103) V; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF150 C elegans ser-5(tm2647) I; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF154 C elegans ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF155 C elegans ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF193 C. elegans ser-4(flv7) III; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF302 C elegans ser-5(tm2647) I; ser-4(flv7) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF380 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF420 C elegans ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF424 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF469 C elegans ser-5(tm2647) I; lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF5 C. elegans flvEx4. Show Description
flvEx4 [rig-3p::wArchon1::GFP + sra-6::ChR2-GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Voltage-sensor protein wArchon1 transgene injected into N2 background. Reference: Piatkevich KD, et al. Nature Chemical Biology. 2018. doi:10.1038/s41589-018-0004-9.
SWF7 C elegans flvEx5. Show Description
flvEx5 [rig-3p::wArchon1::GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Expresses voltage sensor wArchon1 in AVA, tagged with GFP, as well as GFP in the gut from the co-injection marker.
SWF800 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; ser-7(tm1325) ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF911 C elegans ser-5(tm2647) I; ser-4(flv7) lgc-50(flv8) III; mod-1(ok103) V; ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SWF912 C elegans lgc-50(flv8) III; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
SX158 C. elegans prg-1(n4357) I; unc-22(r750) IV. Show Description
Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]
SX2499 C. elegans prde-1(mj207) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2500 C. elegans prde-1(mj258) V. Show Description
piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2650 C. elegans mjSi74 I. Show Description
mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX3073 C. elegans mjIs588 II; unc-119(ed3) III Show Description
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
SX3117 C. elegans emb-4(mjSi92[OLLAS::emb-4]) V. Show Description
mjSi92[OLLAS::emb-4]. Endogenous emb-4 locus tagged with OLLAS epitope. No visible phenotype. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
SX328 C. elegans mjIs17 IV. Show Description
mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].
SX333 C. elegans mjIs11 III; mjIs17 IV. Show Description
mjIs11contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry:unc-54 (let-7 sensor)].
SX392 C. elegans mjEx142. Show Description
mjEx142 [mir-124p::mCherry]. Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.
SX494 C. elegans prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. Show Description
Transposon silencing abnormal. Twitchers.
SX9 C. elegans prg-1(n4503) I; prg-2(nDf57) IV. Show Description
Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.
SX921 C. elegans prg-2(n4358) IV. Show Description
Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.
SX922 C. elegans prg-1(n4357) I. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.
SZ370 C. elegans snu-66(az160) V. Show Description
SNU-66 H765G substitution. No obvious morphological or growth phenotypes were observed. az160 mutation disrupts SNU-66(H765)/SNRP-27(M141) interaction, affecting alternative 5' splice site usage. Worm SNU-66(H765) and SNRP-27(M141) are homologous to human preB spliceosome components snu66(H734) and snrnp27(M141), respectively. Reference: Sarka K, et al. 2024. In submission.
TB1682 C. elegans chEx1682. Show Description
chEx1682 [pLH070(qua-1(full-length)::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions; pick rollers. Reference: Hao et al. (2006) Dev Dyn 235:1469-81.