TJ290 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ292 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ3000 |
C. elegans |
zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
|
|
TJ3001 |
C. elegans |
zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
|
|
TJ3014 |
C. elegans |
zIs3000 II. Show Description
zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.
|
|
TJ375 |
C. elegans |
gpIs1. Show Description
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.
|
|
TK22 |
C. elegans |
mev-1(kn1) III. Show Description
Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.
|
|
TL8 |
C. elegans |
bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
TL9 |
C. elegans |
bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
TN110 |
C. elegans |
twk-18(cn110) X. Show Description
Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.
|
|
TN308 |
C. elegans |
hab-1(cn308) I. Show Description
The hab-1(cn308) mutant is slowly habituated and rapidly recovered from habituation when given repetitive mechanical stimuli.
|
|
TOG1 |
C. elegans |
mfsd-6(ogr1) III. Show Description
Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877
|
|
TOG3 |
C. elegans |
Y74C10AL.2(ogr3) I. Show Description
Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa
|
|
TP12 |
C. elegans |
kaIs12. Show Description
kaIs12 [col-19::GFP]. Collagen COL-19 with GFP fused to C-terminus localized in the cuticle.
|
|
TP193 |
C. elegans |
rips-1(ij109) V. Show Description
Resistance to strong reducing conditions: dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095
|
|
TP390 |
C. elegans |
mce-1(ok243) I; rips-1(ij109) V. Show Description
mce-1(D2030.5). Strong resistance to reducing agents dithiothreitol (DTT) and 2- mercaptoethanol (2ME). Reference: Winter AD, et al. BMC Biol. 2022 Oct 8;20(1):228. doi: 10.1186/s12915-022-01415-y. PMID:36209095
|
|
TP66 |
C. elegans |
pdi-3(ka1) I. Show Description
mild Dumpy. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61.
|
|
TP67 |
C. elegans |
pdi-1(ka3) III. Show Description
Superficially wild-type. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61.
|
|
TQ10515 |
C. elegans |
seld-1(xu408) IV. Show Description
seld-1(xu408) is a G314E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
TQ10516 |
C. elegans |
scbp-2(xu418) I. Show Description
scbp-2(xu418) is a G47R missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
TQ10517 |
C. elegans |
gspd-1(xu416) IV. Show Description
gspd-1(xu416) is a E375K missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
TQ10520 |
C. elegans |
seld-1(xu415) IV. Show Description
seld-1(xu415) is a G170E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
TQ10521 |
C. elegans |
gsr-1(xu414) III. Show Description
gsr-1(xu414) is a G279E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
TQ10548 |
C. elegans |
trxr-1(xu421) IV. Show Description
trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
TQ1828 |
C. elegans |
pde-1(nj57) pde-5(nj49) I; pde-3(nj59) II; pde-2(tm3098) III. Show Description
Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.
|
|
TQ2183 |
C. elegans |
lite-1(xu7) X; xuEx705. Show Description
xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
|
|
TQ233 |
C. elegans |
trpa-1(ok999) IV. Show Description
Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.
|
|
TQ3032 |
C. elegans |
lite-1(xu7) X; xuEx1040. Show Description
xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
|
|
TS337 |
C. elegans |
unc-2(e55) lin-15B&lin-15A(n765) X; vaIs33. Show Description
vaIs33 [unc-2::GFP + lin-15(+)]. Superficially Wild-type.
|
|
TS465 |
C. elegans |
nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs41. Show Description
vaIs41 [nca-2::GFP + lin-15(+)]. Superficially Wild-type.
|
|
TS469 |
C. elegans |
nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs46. Show Description
vaIs46 [nca-1::GFP + lin-15(+)]. Superficially Wild-type.
|
|
TU166 |
C. elegans |
mec-8(u314) I. Show Description
Reference: Lundquist and Herman 1994 Genetics 138: 83.
|
|
TU1747 |
C. elegans |
deg-3(u662) V. Show Description
Dominant mutant phenotypes: Unc, Mec, Tab, Deg (late embryogenesis to L4). u662 was derived from DnT1 by recombination between the dominant Unc mutation and the recessive Lethal mutation. The dominant Unc mutation is what has been retained in this strain. This Unc mutation has been called unc-?(n754) in DnT1 strains. It is likely that unc-?(n754) and deg-3(u662) are the same mutation.
|
|
TU218 |
C. elegans |
mec-8(u218) I. Show Description
Temperature sensitive. Mechanosensory abnormal at 25 C. Maintain at 15 C. Reference: Chalfie & Sulston (1981) Dev Biol 82:358.
|
|
TU2362 |
C. elegans |
vab-15(u781) X. Show Description
Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.
|
|
TU2589 |
C. elegans |
dpy-20(e1282) IV; uIs25 X. Show Description
uIs25 [mec-18::GFP + dpy-20(+)].
|
|
TU3310 |
C. elegans |
uIs59. Show Description
uIs59 [unc-119p::YFP]. Pan-neuronal YFP expression. Maintain 15-20C. Reference: Calixto A, et al. (2010) Nature Methods 7:554-9.
|
|
TU3311 |
C. elegans |
uIs60. Show Description
uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
TU3335 |
C. elegans |
lin-15B(n744) X; uIs57. Show Description
uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]; appears to map to LG V. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees; sick at 25 C. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
TU3403 |
C. elegans |
ccIs4251 I; sid-1(qt2) V; uIs71. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
TU3568 |
C. elegans |
sid-1(pk3321) him-5(e1490) V; lin-15B(n744) X; uIs71. Show Description
uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific RNAi by feeding. Him (~50% males). Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
TU3595 |
C. elegans |
sid-1(pk3321) him-5(e1490) V; lin-15B(n744) X; uIs72. Show Description
uIs72 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1 + mec-18p::mec-18::GFP]. Hypersensitive neuronal RNAi by feeding. GFP detectable in TRNs. Him (~50% males). Maintain 15-20 degrees. Reference: Chalfie (2010) Worm Breeders Gazette.
|
|
TU6276 |
C. elegans |
uIs115; kuIs70. Show Description
uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by
subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
TU899 |
C. elegans |
stDp2(X;II)/+ II; uDf1 X. Show Description
Strain throws WT and dead eggs.
|
|
TU900 |
C. elegans |
+/szT1 [lon-2(e678)] I; uDf1/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. [4/98: Lon males are sickly and Unc. uDf1 appears to still be present.]
|
|
TV13570 |
C. elegans |
unc-119(ed3) III; nrx-1(wy778[unc-119(+)]) V. Show Description
wy778 is a large deletion in the nrx-1 locus that removes the transmembrane and cytoplasmic domains shared by all NRX-1 isoforms and deletes the short isoform entirely. Reference: Maro GS, et al. Neuron. 2015 Jun 17;86(6):1420-32.
|
|
TV28592 |
C. elegans |
bmdSi339 I; bmdSi297 II; arx-2(wy1814[arx-2::mIAA7::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
TV28593 |
C. elegans |
bmdSi339 I; bmdSi297 II; arx-2(wy1815[arx-2::AID::mNG]) qyIs225 V; lam-2(qy20[lam-2::mNG]) X. Show Description
bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.
|
|
TV775 |
C. elegans |
wyIs58 III. Show Description
wyIs58 [opt-3::GFP::RAB-3 + unc-122p::RFP] III. Reference: Wang J, et al. Science. 2010 Jul 16;329(5989):293.
|
|
TX189 |
C. elegans |
unc-119(ed3) III; teIs1. Show Description
teIs1[(pRL475) oma-1p::oma-1::GFP + (pDPMM016) unc-119(+)].
|
|