More Fields
Strain Species Genotype
SD939 C. elegans mpk-1(ga111) unc-79(e1068) III. Show Description
Unc. Temperature-sensitive sterile. Maintain at 15C. NOTE: Lackenr & Kim (1998) incorrectly states that the ga111 mutant has a T to C transition. The transition is actually T to G giving rise to a Val148Gly substitution. Reference: Lackner MR & Kim SK. Genetics. 1998 Sep;150(1):103-17.
SJ17 C. elegans xbp-1(zc12) III; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. xbp-1(zc12) animals contain a nonsense mutation at residue 11 in the predicted xbp-1 protein. Animals are unable to induce hsp-4::GFP in response to treatment by tunicamycin or heat shock.
SJ4001 C. elegans zcIs1. Show Description
zcIs1 [aip-1::GFP].
SJ4003 C. elegans zcIs3 I. Show Description
zcIs3 [aip-1::GFP] I.
SJ4063 C. elegans zcIs8 X. Show Description
zcIs8 contains [abu-1::GFP].
SJ4151 C. elegans zcIs19. Show Description
zcIs19 contains [ubl-5p::ubl-5::GFP].
SJ4157 C. elegans zcIs21 V. Show Description
zcIs21 contains [hsp-16p::clpp-1(WT)::3xmyc-His tag + myo-3p::GFP].
SJ4197 C. elegans zcIs39 II. Show Description
zcIs39 contains [dve-1p::dve-1::GFP].
SJ4199 C. elegans zcIs40 X. Show Description
zcIs40 [dve-1p::dve-1::3xmyc-His tag + myo-3p::GFP].
SJ4200 C. elegans zcIs41 V. Show Description
zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].
SJ4201 C. elegans zcIs42 X. Show Description
zcIs42 contains [ubl-5p::GFP].
SJ4202 C. elegans zcIs22. Show Description
zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].
SJ4203 C. elegans zcIs39 II; zcIs41 V. Show Description
zcIs39 contains [dve-1p::dve-1::GFP]. zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].
SK4005 C. elegans zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons.
SK4013 C. elegans zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.
SL740 C. elegans dpy-2(e8) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.
SLE1 Escherichia coli E. coli [argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rcn14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase]. Show Description
Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.
SLR115 C. elegans dvIs67. Show Description
dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. Derived by out-crossing CL3462.
SLR158 C. elegans pmk-3(tm745) IV; dvIs67; stxEx12. Show Description
dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. stxEx12 [eft-3p::pmk-3 S(EE)::SL2::mCherry]. Pick animals with mCherry expression in intestinal cells. Reference: Munkacsy E, et al. PLoS Genet. 2016 Jul 15;12(7):e1006133.
SOZ259 C. elegans prx-10(ssd68) Show Description
Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .
SOZ300 C.elegans cyp-37A1(ssd9) II. Show Description
ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.
SOZ511 C. elegans emb-8(ssd89) III. Show Description
emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.
SP1372 C. elegans osm-3(mn357) IV. Show Description
Defective in FITC dye filling.
SP1377 C. elegans dpy-11(e224) V; lin-2(e1309) unc-7(mn384) xol-1(mn467) X. Show Description
Animals are DpyUncVul. Can mate at low frequency. N2 males X SP1377 fail to give male progeny. Weak unc-7 allele when not in lin-2 background.
SP1405 C. elegans che-11(mn387) V. Show Description
Dye-filling mutant.
SP1409 C. elegans che-11(mn393) V. Show Description
Dye-filling mutant.
SP1414 C. elegans che-12(mn399) V. Show Description
Dye-filling mutant.
SP1416 C. elegans che-11(mn404) V. Show Description
Dye-filling mutant.
SP1444 C. elegans che-10(mn403) II. Show Description
Dye-filling defective. Reference: Starich TA, et al. 1995 Genetics 193:171-88
SP1540 C. elegans mnDf111/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and UncVul.
SP1564 C. elegans mec-8(u218) smu-1(mn609) I; unc-52(e669su250ts) II. Show Description
Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.
SP1620 C. elegans che-12(mn389) V. Show Description
Dye-filling mutant.
SP1789 C. elegans unc-115(mn481) X. Show Description
Unc. Isolated from RW7097 and not outcrossed.
SP1914 C. elegans unc-29(e1072) I; mnIs7 X. Show Description
mnIs7 [lin-44::GFP + unc-29(+)].
SP199 C. elegans let-236(mn88) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregates WT, paralysed DpyUnc, and larvae which are arrested. Pick L1-L2 Unc-4's to check for larval lethal phenotype. Maintain strain by picking WT
SP2101 C. elegans ncl-1(e1865) unc-36(e251) III; osm-6(p811) V; mnIs17. Show Description
mnIs17 [osm-6::GFP + unc-36(+)].
SP2123 C. elegans mec-8(u218) smu-1(mn602) I; unc-52(e669su250ts) II. Show Description
Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.
SP225 C. elegans mnDp1 (X;V)/+ V; let-5(mn106) unc-3(e151) X. Show Description
LETHAL LATE LARVAL MATERNAL EFFECT Pick WT to maintain.
SP231 C. elegans mnDp1(X;V)/+ V; unc-3(e151) let-7(mn112) X. Show Description
LETHAL LATE LARVAL SEX-INFLUENCED Maintain by picking WT.
SP236 C. elegans mnDp1 (X;V)/+ V; unc-3(e151) let-16(mn117) X. Show Description
FERTILITY POOR LETHAL EARLY LARVAL Maintain by picking WT.
SP247 C. elegans mnDp1 (X;V)/+ V; unc-3(e151) let-33(mn128) X. Show Description
NOT MALE-RESCUED MATERNAL EFFECT STERILE Maintain by picking WT.
SP2533 C. elegans smu-1(mn415) I; mnIs35. Show Description
mnIs35 [smu-2::GFP + unc-36(+)]. Superficially wild-type. Although unlikely, unc-36 might still be present in the background. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP261 C. elegans mnDp1(X;V)/+ V; mnDf2 X. Show Description
WT PHENOTYPE
SP262 C. elegans mnDp1(X;V)/+ V; mnDf1 X. Show Description
WT Phenotype. Gives dead eggs.
SP2628 C. elegans unc-36(e251) III; mnIs61. Show Description
mnIs61 [dpy-7p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2642 C. elegans unc-36(e251) III; mnIs63. Show Description
mnIs63 [dpy-7p::unc-52(e669)(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP265 C. elegans mnDp1(X;V)/+ V; mnDf4 X. Show Description
WT PHENOTYPE.
SP266 C. elegans mnDp1(X;V)/+ V; mnDf5 X. Show Description
WT PHENOTYPE. Should throw dead eggs.
SP2668 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx142. Show Description
mnEx142 [smu-2::GFP + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP2678 C. elegans unc-36(e251) III; mnIs64. Show Description
mnIs64 [myo-3p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.