More Fields
Strain Species Genotype
PD3165 C. elegans unc-39(ct73) V; ccEx3163. Show Description
ccEx3163 [unc-39p::unc-39 gene (genomic fragment)::GFP::unc-39 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. ccEx3163 carries unc-39 construct pJLY99.1.
PD4092 C. elegans unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I. Show Description
Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
PD4443 C. elegans ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.
PD4788 C. elegans mIs13 I. Show Description
mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. Superficially wild-type. GFP expression in 4-cell embryos, pharyngeal muscle and gut. GFP signal is dim but visible under dissecting scope. See WBG 15 #5 page 20.
PD4790 C. elegans mIs12 II. Show Description
mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.
PD4792 C. elegans mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. See WBG 15 #5 page 20.
PD4793 C. elegans mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.
PD8117 C. elegans smg-1(cc545) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]
PD8119 C. elegans smg-1(cc545) I. Show Description
Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]
PD8601 C. elegans ccDf1/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8602 C. elegans ccDf2/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8603 C. elegans ccDf3/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8604 C. elegans ccDf4/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8605 C. elegans ccDf5/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8607 C. elegans ccDf7/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. Rec'd new stock 8/2000.
PD8611 C. elegans ccDf11/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
PD8662 C. elegans lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975.
PD9753 C. elegans ccIs9753 I. Show Description
ccIs9753 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Medium-strength GFP signal. See WBG 15 #5 page 20.
PE219 C. elegans dab-1(gk291) II; feEx43. Show Description
feEx43 [dab-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Holmes et al. J Cell Sci. 2007 Aug 1;120(Pt 15):2741-51.
PFR39 C. elegans hpl-2(tm1489) unc-49(e407) III. Show Description
Unc. Thermosensitive. Sterile at 25C.
PFR40 C. elegans hpl-2(tm1489) III. Show Description
Thermosensitive. Sterile at 25C.
PFR60 C. elegans hpl-1(tm1624) X. Show Description
Wild type phenotype.
PG-1 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-2 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PG-3 Unknown species Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
PHX1364 C. elegans hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. Show Description
mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281
PHX2307 C. elegans ceh-13(syb2307[ceh-13::mNG::AID]) III. Show Description
mNeonGreen and AID tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX2361 C.elegans egl-5(syb2361[egl-5::mNG::AID]) III. Show Description
mNeonGreen and AID tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX2493 C elegans lgc-38(syb2346[flp-11p::dpy-10 site::flp-11UTR] syb2493[ReaChR::linker::mKate2]) III. Show Description
ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX2616 C. elegans ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. Show Description
Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX267 C. elegans ikb-1(syb267[ikb-1::mCherry]) I. Show Description
mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
PHX2685 C. elegans ins-6(syb2685[ins-6::T2A::3xNLS::GFP]) II. Show Description
Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX2704 C. elegans nlp-50(syb2704[nlp-50::T2A::3xNLS::GFP]) II. Show Description
Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3112 C. elegans nlp-12(syb3112[nlp-12::T2A::3×NLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3169 C. elegans flp-12(syb3169[flp-12::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3172 C. elegans flp-25(syb3172[flp-25::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3179 C. elegans nlp-10(syb3179[nlp-10::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3184 C. elegans flp-17(syb3184[flp-17::T2A::3xNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3187 C. elegans flp-10(syb3187[flp-10::T2A::3xNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3193 C. elegans flp-18(syb3193[flp-18::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3195 C elegans flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. Show Description
GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
PHX3207 C. elegans flp-28(syb3207[flp-28::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-28 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3222 C. elegans nlp-17(syb3222[nlp-17::T2A::3×NLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3229 C. elegans flp-9(syb3229[flp-9::T2A::3xNLS::GFP]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3230 C. elegans flp-15(syb3230[flp-15::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3240 C. elegans nlp-1(syb3240[nlp-1::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3242 C. elegans flp-23(syb3242[flp-23::T2A::3xNLS::GFP]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3250 C. elegans capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3251 C. elegans flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3257 C. elegans flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.