More Fields
Strain Species Genotype
TJ202 C. elegans Show Description
No fertility at 25C.
TJ207 C. elegans Show Description
No fertility at 25C.
TJ215 C. elegans Show Description
No fertility at 25C.
TJ225 C. elegans Show Description
No fertility at 25C.
TJ236 C. elegans Show Description
No fertility at 25C.
TJ239 C. elegans Show Description
No fertility at 25C.
TJ242 C. elegans Show Description
No fertility at 25C.
TJ246 C. elegans Show Description
No fertility at 25C.
TJ251 C. elegans Show Description
No fertility at 25C.
TJ257 C. elegans Show Description
No fertility at 25C.
TJ264 C. elegans Show Description
No fertility at 25C.
TJ265 C. elegans Show Description
No fertility at 25C.
TJ273 C. elegans Show Description
No fertility at 25C.
TJ274 C. elegans Show Description
No fertility at 25C.
TJ277 C. elegans Show Description
No fertility at 25C.
TJ282 C. elegans Show Description
No fertility at 25C.
TJ286 C. elegans Show Description
No fertility at 25C.
TJ290 C. elegans Show Description
No fertility at 25C.
TJ292 C. elegans Show Description
No fertility at 25C.
TJ3000 C. elegans zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3001 C. elegans zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3014 C. elegans zIs3000 II. Show Description
zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.
TJ375 C. elegans gpIs1. Show Description
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.
TK22 C. elegans mev-1(kn1) III. Show Description
Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.
TL8 C. elegans bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
TL9 C. elegans bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
TN110 C. elegans twk-18(cn110) X. Show Description
Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.
TN308 C. elegans hab-1(cn308) I. Show Description
The hab-1(cn308) mutant is slowly habituated and rapidly recovered from habituation when given repetitive mechanical stimuli.
TOG1 C. elegans mfsd-6(ogr1) III. Show Description
Slow growth, Slow movement. ogr1 is a 1.2 kb deletion causing a frameshift at residue 54 and premature stop at residue 83. Reference: Ogurusu T, et al. Biochem Biophys Res Commun. 2015 Aug 7;463(4):994-8. PMID: 26079877
TOG3 C. elegans Y74C10AL.2(ogr3) I. Show Description
Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa
TP12 C. elegans kaIs12. Show Description
kaIs12[col-19::GFP]. Collagen COL-19 with GFP fused to C-terminus localised in the cuticle.
TP66 C. elegans pdi-3(ka1) I. Show Description
mild Dumpy. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61.
TP67 C. elegans pdi-1(ka3) III. Show Description
Superficially wild-type. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61.
TQ10515 C. elegans seld-1(xu408) IV. Show Description
seld-1(xu408) is a G314E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10516 C. elegans scbp-2(xu418) I. Show Description
scbp-2(xu418) is a G47R missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10517 C. elegans gspd-1(xu416) IV. Show Description
gspd-1(xu416) is a E375K missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10520 C. elegans seld-1(xu415) IV. Show Description
seld-1(xu415) is a G170E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10521 C. elegans gsr-1(xu414) III. Show Description
gsr-1(xu414) is a G279E missense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ10548 C. elegans trxr-1(xu421) IV. Show Description
trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
TQ1828 C. elegans pde-1(nj57) pde-5(nj49) I; pde-3(nj59) II; pde-2(tm3098) III. Show Description
Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.
TQ2183 C. elegans lite-1(xu7) X; xuEx705. Show Description
xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TQ233 C. elegans trpa-1(ok999) IV. Show Description
Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.
TQ3032 C. elegans lite-1(xu7) X; xuEx1040. Show Description
xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TS337 C. elegans unc-2(e55) lin-15B&lin-15A(n765) X; vaIs33. Show Description
vaIs33 [unc-2::GFP + lin-15(+)]. Superficially Wild-type.
TS465 C. elegans nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs41. Show Description
vaIs41 [nca-2::GFP + lin-15(+)]. Superficially Wild-type.
TS469 C. elegans nca-2(gk5) III; unc-77(gk9) IV; lin-15B&lin-15A(n765) X; vaIs46. Show Description
vaIs46 [nca-1::GFP + lin-15(+)]. Superficially Wild-type.
TU166 C. elegans mec-8(u314) I. Show Description
Reference: Lundquist and Herman 1994 Genetics 138: 83.
TU1747 C. elegans deg-3(u662) V. Show Description
Dominant mutant phenotypes: Unc, Mec, Tab, Deg (late embryogenesis to L4). u662 was derived from DnT1 by recombination between the dominant Unc mutation and the recessive Lethal mutation. The dominant Unc mutation is what has been retained in this strain. This Unc mutation has been called unc-?(n754) in DnT1 strains. It is likely that unc-?(n754) and deg-3(u662) are the same mutation.
TU218 C. elegans mec-8(u218) I. Show Description
Temperature sensitive. Mechanosensory abnormal at 25 C. Maintain at 15 C. Reference: Chalfie & Sulston (1981) Dev Biol 82:358.
TU2362 C. elegans vab-15(u781) X. Show Description
Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.