More Fields
Strain Species Genotype
TG4319 C. elegans lem-3(tm3468) I. Show Description
Homozygous viable. Increased embryonic lethality after irradiation.
TH113 C. elegans let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
TH26 C. elegans unc-119(ed3) III; ddEx10. Show Description
ddEx10 [pie-1p::GFP::sas-4 + unc-119(+)]. Maintain by picking non-Unc.
TH27 C. elegans unc-119(ed3) III; ddIs6 V. Show Description
ddIs6 [tbg-1::GFP + unc-119(+)] V.
TH32 C. elegans unc-119(ed3) ruIs32 III; ddIs6 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V.
TH48 C. elegans mbk-2(dd5) IV. Show Description
Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.
TH61 C. elegans unc-119(ed3) III; ddIs36. Show Description
ddIs36 [pie-1p::GFP::sas-5 + unc-119(+)].
TH65 C. elegans unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
TJ101 C. elegans Show Description
No fertility at 25C.
TJ103 C. elegans Show Description
No fertility at 25C.
TJ104 C. elegans Show Description
No fertility at 25C.
TJ105 C. elegans Show Description
No fertility at 25C.
TJ1052 C. elegans age-1(hx546) II. Show Description
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
TJ106 C. elegans Show Description
No fertility at 25C.
TJ107 C. elegans Show Description
No fertility at 25C.
TJ108 C. elegans Show Description
No fertility at 25C.
TJ112 C. elegans Show Description
No fertility at 25C.
TJ121 C. elegans Show Description
No fertility at 25C.
TJ123 C. elegans Show Description
No fertility at 25C.
TJ127 C. elegans Show Description
No fertility at 25C.
TJ131 C. elegans Show Description
No fertility at 25C.
TJ146 C. elegans Show Description
No fertility at 25C.
TJ202 C. elegans Show Description
No fertility at 25C.
TJ207 C. elegans Show Description
No fertility at 25C.
TJ215 C. elegans Show Description
No fertility at 25C.
TJ225 C. elegans Show Description
No fertility at 25C.
TJ236 C. elegans Show Description
No fertility at 25C.
TJ239 C. elegans Show Description
No fertility at 25C.
TJ242 C. elegans Show Description
No fertility at 25C.
TJ246 C. elegans Show Description
No fertility at 25C.
TJ251 C. elegans Show Description
No fertility at 25C.
TJ257 C. elegans Show Description
No fertility at 25C.
TJ264 C. elegans Show Description
No fertility at 25C.
TJ265 C. elegans Show Description
No fertility at 25C.
TJ273 C. elegans Show Description
No fertility at 25C.
TJ274 C. elegans Show Description
No fertility at 25C.
TJ277 C. elegans Show Description
No fertility at 25C.
TJ282 C. elegans Show Description
No fertility at 25C.
TJ286 C. elegans Show Description
No fertility at 25C.
TJ290 C. elegans Show Description
No fertility at 25C.
TJ292 C. elegans Show Description
No fertility at 25C.
TJ3000 C. elegans zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3001 C. elegans zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3014 C. elegans zIs3000 II. Show Description
zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.
TJ375 C. elegans gpIs1. Show Description
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.
TK22 C. elegans mev-1(kn1) III. Show Description
Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.
TL8 C. elegans bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
TL9 C. elegans bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
TN110 C. elegans twk-18(cn110) X. Show Description
Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.
TN308 C. elegans hab-1(cn308) I. Show Description
The hab-1(cn308) mutant is slowly habituated and rapidly recovered from habituation when given repetitive mechanical stimuli.