TG4319 |
C. elegans |
lem-3(tm3468) I. Show Description
Homozygous viable. Increased embryonic lethality after irradiation.
|
|
TH113 |
C. elegans |
let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
|
|
TH26 |
C. elegans |
unc-119(ed3) III; ddEx10. Show Description
ddEx10 [pie-1p::GFP::sas-4 + unc-119(+)]. Maintain by picking non-Unc.
|
|
TH27 |
C. elegans |
unc-119(ed3) III; ddIs6 V. Show Description
ddIs6 [tbg-1::GFP + unc-119(+)] V.
|
|
TH32 |
C. elegans |
unc-119(ed3) ruIs32 III; ddIs6 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V.
|
|
TH48 |
C. elegans |
mbk-2(dd5) IV. Show Description
Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.
|
|
TH61 |
C. elegans |
unc-119(ed3) III; ddIs36. Show Description
ddIs36 [pie-1p::GFP::sas-5 + unc-119(+)].
|
|
TH65 |
C. elegans |
unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
|
|
TJ101 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ103 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ104 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ105 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ1052 |
C. elegans |
age-1(hx546) II. Show Description
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
|
|
TJ106 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ107 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ108 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ112 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ121 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ123 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ127 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ131 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ146 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ202 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ207 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ215 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ225 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ236 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ239 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ242 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ246 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ251 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ257 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ264 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ265 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ273 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ274 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ277 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ282 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ286 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ290 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ292 |
C. elegans |
Show Description
No fertility at 25C.
|
|
TJ3000 |
C. elegans |
zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
|
|
TJ3001 |
C. elegans |
zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
|
|
TJ3014 |
C. elegans |
zIs3000 II. Show Description
zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.
|
|
TJ375 |
C. elegans |
gpIs1. Show Description
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Insertion not mapped.
|
|
TK22 |
C. elegans |
mev-1(kn1) III. Show Description
Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.
|
|
TL8 |
C. elegans |
bam-2(cy6) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
TL9 |
C. elegans |
bam-2(cy7) I; cyIs4 V. Show Description
cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.
|
|
TN110 |
C. elegans |
twk-18(cn110) X. Show Description
Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.
|
|
TN308 |
C. elegans |
hab-1(cn308) I. Show Description
The hab-1(cn308) mutant is slowly habituated and rapidly recovered from habituation when given repetitive mechanical stimuli.
|
|