mScarlet and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.

jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs.

jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.

jcIs25 [pPE103 (jac-1::GFP) + rol-6(su1006)]. Rollers. Reference: Pettitt et al. 2003. LCB 162:15-22.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.

mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663.

mNeonGreen and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.

heIs63 [wrt-2p::GFP::PH + wrt-2p::GFP::H2B + lin-48p::mCherry] V. GFP expression in seam cells and mCherry expression in pharynx. Reference: Wildwater M, et al. Development. 2011 Oct;138(20):4375-85.

heSi45 [mcm-4::mCherry + unc-119(+)] IV. This strain contains an S-phase marker that will express mCherry in all cells that undergo cell division, providing a useful alternative to BrdU and EdU staining that is suitable for live imaging. References: Korzelius J, et al. Dev Biol. 2011 Feb 15;350(2):358-69. Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362.

This strain carries endogenously tagged dynein heavy chain (mCherry::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038

This strain carries endogenously tagged dynein heavy chain (egfp::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038

eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.

eGFP tag inserted into endogenous pop-1 locus. The homozygous gfp::pop-1 strain is viable, although not fully healthy and occasionally missing a seam cell. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvEx4 [rig-3p::wArchon1::GFP + sra-6::ChR2-GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Voltage-sensor protein wArchon1 transgene injected into N2 background. Reference: Piatkevich KD, et al. Nature Chemical Biology. 2018. doi:10.1038/s41589-018-0004-9.

flvEx5 [rig-3p::wArchon1::GFP + elt-2p::nGFP]. Pick GFP+ to maintain. Expresses voltage sensor wArchon1 in AVA, tagged with GFP, as well as GFP in the gut from the co-injection marker.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]

piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.

piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.

mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.

mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.

mjSi92[OLLAS::emb-4]. Endogenous emb-4 locus tagged with OLLAS epitope. No visible phenotype. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.

mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].

mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].

mjEx142 [mir-124p::mCherry]. Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.

Transposon silencing abnormal. Twitchers.

Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.

Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.

21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.

SNU-66 H765G substitution. No obvious morphological or growth phenotypes were observed. az160 mutation disrupts SNU-66(H765)/SNRP-27(M141) interaction, affecting alternative 5' splice site usage. Worm SNU-66(H765) and SNRP-27(M141) are homologous to human preB spliceosome components snu66(H734) and snrnp27(M141), respectively. Reference: Sarka K, et al. 2024. In submission.

chEx1682 [pLH070(qua-1(full-length)::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions; pick rollers. Reference: Hao et al. (2006) Dev Dyn 235:1469-81.

PHA and PHB dye-filling defect. About 50% athermotactic. ch3 deletes exon 3, causes frameshift and premature stop. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background.]

Reference: Bailly AP, et al. PLoS Genet. 2010 Jul 15;6(7):e1001025. Agostinho A, et al. PLos Genetics 2013.

411 bp deletion removes exons 6-8. Homozygotes are viable, but are hypersensitive to DNA crosslinking.

Reference: Agostinho A, et al. PLos Genetics 2013.

vtIs1 [dat-1p::GFP + rol-6] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.