More Fields
Strain Species Genotype
VC4120 C. elegans dhs-29(gk5199) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.
VC4121 C. elegans C36B7.3(gk5200) ent-2(gk5201) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.
VC4122 C. elegans F53G12.9(gk5202) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5202 mutation is G->A, flanking sequences TTTCTTCGGAGCAAGCTAATTCCCTATGAA and TGAGAGCATTTAGGTTAATAAACATAGTCC.
VC4123 C. elegans srw-68(gk5203) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5203 mutation is C->T, flanking sequences TGATGAAATTTTTATGCTAGAATTTTCGAA and CTATTTTCCGATCCATTTCGTTGTGATATC.
VC4124 C. elegans R07E3.7(gk5204) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing.The gk5204 mutation is A->T, flanking sequences TGGAGGTTGCTTTTTGTCTTTTGATCGTAT and CAGAAAAATAGGATGAGAATCAACAGAACG.
VC4125 C. elegans ptr-13(gk5205) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT.
VC4126 C. elegans Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.
VC4127 C. elegans ZC334.7(gk5207) I; cnnm-5(gk5208) III; K08H2.10(gk5209) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. The gk5209 mutation is G->T, flanking sequences AAAAAGGAAGACATTGAGTTTGAGGATACA and AACGTCGAATTCATTCTCGAAGTGTTCGAA.
VC4132 C. elegans srz-38(gk5214) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5214 mutation is C->T, flanking sequences TTACTGTTTCCAGCAGTCAATCATTTCTAT and AAATGACAAGAAACGTTTTTTTCCTCTGCA.
VC4133 C. elegans hot-6(gk5215) V. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5215 mutation is G->A, flanking sequences CACCAATTGGATAAAAGAAAATATCAGTTT and AGTTGCAAGTTGTCGACGAACTGTTGCATT.
VC4134 C. elegans ZK1225.1(gk5216) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA.
VC4135 C. elegans fbxa-182(gk5217) II; srbc-70(gk5218) IV. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT.
VC4156 C. elegans R12C12.6(gk5239) II; clec-56(gk5240) V. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA.
VC4157 C. elegans glct-4(gk5241) I; C05D2.8(gk5242) III. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5241 mutation is C->T, flanking sequences GAGCTTCCACAACGACTCCTCCGACTAGGC and TGAAATTTTAGGGGGTTCTGGGATTGAGGT. The gk5242 mutation is C->T, flanking sequences ACAATATCCCTCTCTCCTCCATCACCACCC and ACTGAGAATTCATCAAATTTTCTTTATTGT.
VC4158 C. elegans AH9.1(gk5243) K09C4.10(gk5244) X. Show Description
Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5243 mutation is C->T, flanking sequences TTCAGTCCGACTGTTTTGTGATGGCTGTCT and CAGAACCAATTACGTTTGTCAATTTTCCGC. The gk5244 mutation is C->A, flanking sequences TGTCTGATCCTTTCTCAATAGTTCCATCCT and GCGCTTTTCAGCAATATGATTTTCAGATCC.
VC4177 C. elegans fipr-3(gk5263) K09E3.5(gk5264) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5263 mutation is G->A, flanking sequences TTTTTCGTATTTTCAATTTCCAATGTTTCA and CCTTCTTTGTGTCCTTGCCTTGGTCATGTG. The gk5264 mutation is G->A, flanking sequences ATCTTCTTACCTTTGCTCCTTTCGGAGCTT and ATCTTCCCAGCTGATTTCCCTGGCCATAGA.
VC4178 C. elegans W03G9.2(gk5265) I; C34F11.1(gk5266) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5265 mutation is G->A, flanking sequences GAAATGACCGCCGAACTGAAGAAGTTAAAG and TGATATATACAACAATGAACAATCACTAAT. The gk5266 mutation is C->T, flanking sequences TCAGGCTCATGGCGAGCTCTTCCAGTGGCA and AAGGCGGTTCCTCACATATTCGTATCTGGC.
VC4181 C. elegans clec-91(gk5267) I. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5267 mutation is C->T, flanking sequences AATGCGCTGGTGCCAAGATCCTTGTGGTCC and AGTTGTAGTATGTCACTGTAAGATTGATTA.
VC4182 C. elegans nol-16(gk5268) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5268 mutation is G->A, flanking sequences TGCTCATTGATTCATAATTTTGAATTTTCA and AAAGAGATCATCGACGCGGAGCCAATTGAC.
VC4209 C. elegans C29F9.8(gk5294) III; fbxa-139(gk5295) V. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5294 mutation is C->T, flanking sequences CAGAAAAGTACAAATTTGCCTGGATTTTGC and TGAAAATTTTTATCAAAAAACCGGCAAATT. The gk5295 mutation is G->A, flanking sequences GATTAAATCTGATTAGATGAAGCTCAAATC and ATCGAAGTTGTAGAGATACTCCATTGGCAT.
VC4210 C. elegans frpr-2(gk5296) X. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5296 mutation is G->A, flanking sequences ATAGAGGGGTACGCGGGAGTTGCCAATCTG and TAAGTATACTGAAAACCCTAGTTTTCGAGG.
VC4211 C. elegans C03B1.1(gk5297) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5297 mutation is C->T, flanking sequences TTGTACGACGAGTCATGCTGTGTTGGAGCC and GAGGTCGTGATGTCTATCTAAATTTCGGTC.
VC4212 C. elegans C56A3.8(gk5298) V. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5298 mutation is G->A, flanking sequences ATAATTTTAAGGAAAAAATTAAATTTTTCA and AAACTTTTCCGTCACGGAATCGCTAGCTCC.
VC4213 C. elegans tsp-19(gk5299) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5299 mutation is G->A, flanking sequences AAAAGTCATATAATGACATATGTAAACCCG and TGAGTGACGGATTGAATGAAGTCCATTATC.
VC4214 C. elegans D2005.4(gk5300) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.
VF1 C. elegans unc-119(ed3) III; gfEx1. Show Description
gfEx1 [hmt-1p::GFP + unc-119(+)]. Maintain under normal conditions. GFP expression detected in Intestinal cells, terminal pharyngeal bulb, coelomocytes, and head & tail neurons. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF14 C. elegans arIs37 I; unc-119(ed3) hmt-1(gk161) III; cdIs32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. Hypersensitive to cadmium. Lacks coelomocytes and accumulates GFP in pseudocoelome. Maintain under normal conditions. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF2 C. elegans pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF3 C. elegans hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF8 C. elegans hmt-1(gk155) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 416 bp deletion encompasses exon 1; in-frame Met present in second exon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VF9 C. elegans pcs-1(tm1748) II; hmt-1(gk161) III. Show Description
Acute hypersensitivity to heavy metals (Cd, As, Cu). Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VH1075 C. elegans rhIs4 hdIs26 III; fmi-1(rh308) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH1160 C. elegans ast-1(hd92) II; rhIs4 III; hdEx237. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdEx237 [ast-1(+) + rol-6(su1006)]. hd92 arrests as L1 due to pharyngeal differentiation defects; ventral cord midline crossing defects; rescued with ast-1(+) transgene. Rollers.
VH1195 C. elegans hdIs42. Show Description
hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.
VH1348 C. elegans nas-7(hd116) II. Show Description
Superficially wild-type. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
VH1565 C. elegans rhIs4 hdIs26 III; fmi-1(hd121) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
VH17 C. elegans ast-1(rh300) II; rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Ventral cord midline crossing defects.
VH1940 C. elegans cdh-4(hd40) III. Show Description
Partially penetrant embryonic and larval lethality. Variable morphological defects. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
VH254 C. elegans pha-1(e2123) III; hdEx81. Show Description
hdEx81 [F25B3.3::tau352(PHP) + pha-1(+)]. Maintain at 25C to select for array. Animals become progressively uncoordinated with age. Reference: Brandt R, et al. Neurobiol Aging. 2009 Jan;30(1):22-33.
VH255 C. elegans pha-1(e2123) III; hdEx82. Show Description
hdEx82 [F25B3.3::tau352(WT) + pha-1(+)]. Maintain at 25C to select for array. Animals become progressively uncoordinated with age. Reference: Brandt R, et al. Neurobiol Aging. 2009 Jan;30(1):22-33.
VH29 C. elegans cdh-4(rh310) rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Lateral axons and ventral cord cross-over defects. Partially penetrant embryonic and larval lethality. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
VH624 C. elegans rhIs13 V; nre-1(hd20) lin-15B(hd126) X. Show Description
rhIs13 [unc-119::GFP + dpy-20(+)]. RNAi hypersensitive, effective RNAi in the nervous system. unc-119::GFP in neurons is almost completely suppressed on anti-GFP RNAi plates. Reduced progeny at 25C (almost sterile). nre-1(hd20) and lin-15B(hd126) seem very closely linked. Maintain at 15C or 20C.
VH715 C. elegans hdIs17 I; hdIs10 V; nre-1(hd20) lin-15B(hd126) X. Show Description
hdIs17 [glr-1::YFP + unc-47::YFP + unc-129::YFP + rol-6(su1006)]. hdIs10 [unc-129::CFP + glr-1::YFP + unc-47::DsRed + hsp-16::rol-6(su1006)]. Rollers. Reduced progeny at 25C (almost sterile). RNAi hypersensitive, effective RNAi in the nervous system. unc-47::DsRed is weak and only visible in adults. hsp-16::rol-6 transgene is not effectively Roll. Maintain at 15 or 20C.
VH742 C. elegans tsn-1(hd42) II. Show Description
F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.
VK1093 C. elegans vkEx1093. Show Description
vkEx1093 [nhx-2p::mCherry::lgg-1]. Maintain by picking mCherry+ animals. Increased puncta under autophagy conditions. Reference: Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460.
VK1104 C. elegans vkEx1104. Show Description
vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1241 C. elegans vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1256 C. elegans vkEx1256. Show Description
vkEx1256 [nhx-2p::cpl-1::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1258 C. elegans vkEx1258. Show Description
vkEx1258 [nhx-2p::cpl-1(W32AY35A)::YFP + nhx-2p::DsRed::KDEL]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
VK1260 C. elegans vkEx1260. Show Description
vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.