xtEx66 [ftn-1p(G2m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx72 [ftn-1p(G12m)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

xtEx79 [pes-10(+63)::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

Strain VC30089 should be named VC30126. Please use VC30126 when referring to the strain.

Homozygous lethal or sterile deletion balanced by translocation marked with dpy-10(e128). Heterozygotes are fertile WT and segregate fertile WT, gk3387 homozygotes (sterile adults that tend to explode at vulva), dead eggs (aneuploids) and sterile Dpy-10 mT1 homozygotes. Pick fertile WT to maintain. Reasonably well balanced but not perfect.

Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.

Homozygous viable. Splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense alleles identified by amplicon sequencing.

Homozygous viable. Nonsense alleles and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Splicing defects identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Splicing defect identified by amplicon sequencing.

Homozygous viable. Splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Nonsense allele identified by amplicon sequencing.

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5173 mutation is G->A, flanking sequences ATATGTAAAAACTCACCTCTTGGAAGTACT and ATCGTTTCCATTGATATGATCCATCCAGAC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5175 mutation is C->T, flanking sequences TCAATCCGCAAAAAGATGCAGAGAAGGTAA and TGAAAAATTGTGTAGGTAAGAAAAAAAAAA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5177 mutation is C->T, flanking sequences TGTTATACAATTAAATTTAAAAAATCCTTA and CGAGACATCCACAAAGAGTGTAAACGATTA.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5178 mutation is G->A, flanking sequences GCAGAAACATAGAAACTTTGAAATTTTTCA and ATACCTCATGTAGTCGAATGCCTGCACATA.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5179 mutation is C->T, flanking sequences GGTGAAGCTGAGGCATTACGCGCTTCTCGT and TGAAAAATTTTAATGGATTTTTTGATTCTT. The gk5180 mutation is G->A, flanking sequences AAACTGAAAAGAAGACGTTTCCAATGCTTT and GGATTCTCAACTTATGAATAATCCGATATT. The gk5181 mutation is T->A, flanking sequences AGCATTTGCAGACGGAGATTTTACAACTTG and GAAGAAAATTTTAAAAGACGAGTTGAATCC.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5184 mutation is G->A, flanking sequences CCGACTTGCTGACTGCATTCGGAAGACTAT and GAATAGTGGCCTCGGCGCTTATATGAAACA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.

Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5192 mutation is G->A, flanking sequences TCCAAGCAAGGCACAAATTCTTGAAGCTTG and GAAAATGGAGCCGAACCTTGGCAATCTACC. The gk5193 mutation is C->T, flanking sequences AGACGATTCGAAAGTCGACAATCAATCTTA and AATTGCGAAGTAAGTGAAAGTGAGAACTTT. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is G->A, flanking sequences TACCTGGGCTCTTTGGAACAAAAGAAAACT and GATCCAAGTCGGCAAAGATCTCAGTCAACG.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5197 mutation is G->A, flanking sequences AAATTGGATCCTTTCTACTATGTTGAACTT and CATCACTTCCATTTCATTTTCATCGTTTTT.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5202 mutation is G->A, flanking sequences TTTCTTCGGAGCAAGCTAATTCCCTATGAA and TGAGAGCATTTAGGTTAATAAACATAGTCC.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5203 mutation is C->T, flanking sequences TGATGAAATTTTTATGCTAGAATTTTCGAA and CTATTTTCCGATCCATTTCGTTGTGATATC.

Homozygous viable. Nonsense allele identified by amplicon sequencing.The gk5204 mutation is A->T, flanking sequences TGGAGGTTGCTTTTTGTCTTTTGATCGTAT and CAGAAAAATAGGATGAGAATCAACAGAACG.