| TG1878 |
C. elegans |
mus-81(tm1937) slx-1(tm2644) I. Show Description
Reference: Agostinho A, et al. PLos Genetics 2013.
|
|
| TG2196 |
C. elegans |
him-6(ok412) spo-11(me44) IV/nT1 (IV;V). Show Description
Him. Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. Reference: Agostinho A, et al. PLos Genetics 2013.
|
|
| TG2226 |
C. elegans |
xpc-1(tm3886) IV. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.
|
|
| TG2228 |
C. elegans |
polq-1(tm2026) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Muzzini DM, et al. DNA Repair (Amst.) 2008 Jun 1;7(6):941-50.
|
|
| TG2367 |
C. elegans |
unc-119(ed3) III; gtIs2367/+. Show Description
gtIs2367 [pie-1p::GFP(lap)::orc-5 + unc-119(+)]. Maintain by picking non-Unc. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG2368 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; gtIs2368. Show Description
gtIs2368 [pie-1p::GFP(lap)::rpa-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
|
|
| TG2394 |
C. elegans |
cat-2(e1112) II; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2401 |
C. elegans |
dat-1(ok157) III; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Many animals roll weakly or not at all, but still express GFP. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2411 |
C. elegans |
vtIs1 dop-2(vs105) V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2415 |
C. elegans |
vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2416 |
C. elegans |
vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2435 |
C. elegans |
vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2436 |
C. elegans |
vtIs1 V; tsp-17(tm4995) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. [NOTE: tsp-17(tm4995) is the correct allele carried in this strain. The genotype was annotated incorrectly in Masoudi N, et al. (S. Mitani, 11/2016)] Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2437 |
C. elegans |
vtIs1 V; tsp-17(tm5169) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
|
|
| TG2519 |
C. elegans |
rip-1(tm2948) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Taylor MRG, et al. Cell. 2015 Jul 16;162(2):271-286.
|
|
| TG2520 |
C. elegans |
pole-4(tm4613) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.
|
|
| TG2932 |
C. elegans |
tdpo-1(gk889420) IV. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG2978 |
C. elegans |
rev-1(gk924750) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG3320 |
C. elegans |
apn-1(cxTi10435) II. Show Description
Superficially wild-type. Deletion site verified by PCR. Mos transposon insertion into apn-1; insertion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG3525 |
C. elegans |
fnci-1(tm3081) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG3527 |
C. elegans |
fncm-1(tm3148) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG3796 |
C. elegans |
bub-3(gt2000) II. Show Description
Y54G9A.6. Nonsense C to T transition. IR sensitive. To genotype: WT left mismatch primer: GAAACAGGCAACGGAACAC; mutant left mismatch primer: GAAACAGGCAACGGAAACT; right mismatch primer: CTCTTCATCATCTCCTCTCC. WT and mutant amplicon: 407 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
|
|
| TG3867 |
C. elegans |
xpg-1(tm1670) I. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306
|
|
| TG3880 |
C. elegans |
rev-3(gk919715) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.
|
|
| TG3967 |
C. elegans |
bub-3(ok3437) II Show Description
Y54G9A.6. IR sensitive. To genotype: External left primer: GTCCCGTTTCCCCCATTTG. External right primer: CTCTTCATCATCTCCTCTCC. Internal right primer: CTCCTCCGAACGCTACTT. External WT amplicon: 1970 bp. External mutant amplicon: 1635 bp. Internal WT amplicon: 1534 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885. Kim T, et al. J Cell Biol. 2015 May 25;209(4):507-17.
|
|
| TG3969 |
C. elegans |
san-1(ok1580) I. Show Description
ZC328.4. IR sensitive. External left primer: AACAAGAAGGGGAAGAAAGA. External right primer: TGTCTCATCGAAATCCAACT. Internal Left Sequence: AGGAAGAAACGAGAAAAGCA. External WT amplicon: 1420 bp. External mutant amplicon: 428 bp. Internal WT amplicon: 720 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
|
|
| TG4094 |
C. elegans |
unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. Show Description
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
| TG4100 |
C. elegans |
vtIs1 V; glit-1(gt1981) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
| TG4103 |
C. elegans |
ttr-33(gt1983) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
| TG4267 |
C. elegans |
lem-3(gt3309[eGFP::Stag::lem-3]) I. Show Description
GFP tag inserted into endogenous lem-3 locus by CRISPR. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
|
|
| TG4281 |
C. elegans |
unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
| TG4298 |
C. elegans |
lem-3(gt3310[eGFP::STag::lem-3[S192A S194A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
|
|
| TG4319 |
C. elegans |
lem-3(tm3468) I. Show Description
Homozygous viable. Increased embryonic lethality after irradiation.
|
|
| TH113 |
C. elegans |
let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
|
|
| TH26 |
C. elegans |
unc-119(ed3) III; ddEx10. Show Description
ddEx10 [pie-1p::GFP::sas-4 + unc-119(+)]. Maintain by picking non-Unc.
|
|
| TH27 |
C. elegans |
unc-119(ed3) III; ddIs6 V. Show Description
ddIs6 [tbg-1::GFP + unc-119(+)] V.
|
|
| TH32 |
C. elegans |
unc-119(ed3) ruIs32 III; ddIs6 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V.
|
|
| TH48 |
C. elegans |
mbk-2(dd5) IV. Show Description
Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.
|
|
| TH61 |
C. elegans |
unc-119(ed3) III; ddIs36. Show Description
ddIs36 [pie-1p::GFP::sas-5 + unc-119(+)].
|
|
| TH65 |
C. elegans |
unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
|
|
| TJ101 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ103 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ104 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ105 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ1052 |
C. elegans |
age-1(hx546) II. Show Description
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
|
|
| TJ106 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ107 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ108 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ112 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ121 |
C. elegans |
Show Description
No fertility at 25C.
|
|