| OH18011 |
C. elegans |
pha-1(e2123) III; otEx7947. Show Description
otEx7947 [W02A2.5p::GFP + pha-1(+)]. I3 neurons are labeled with GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
|
| OH18012 |
C. elegans |
pha-1(e2123) III; otEx7948. Show Description
otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). |
|
| OH18145 |
C. elegans |
otIs883. Show Description
otIs883 [srab-20p::GFP::cla-1 + unc-122p::mCherry]. Presynaptic GFP::cla-1 reporter for PHB neurons. Reference: Majeed M, et al. Elife. 2024 Jan 15:12:RP91775. doi: 10.7554/eLife.91775. PMID: 38224479. |
|
| OH18190 |
Pristionchus pacificus |
unc-4(ot5018) II. Show Description
unc |
|
| OH18424 |
C. elegans |
pha-1(e2123) III; otEx8047. Show Description
otEx8047 [pks-1p::TagRFP + pha-1(+)]. Maintain at 25C to select for array. TagRFP expression marks CAN neurons. |
|
| OH1849 |
C. elegans |
pha-1(e2123) III; otEx980. Show Description
otEx980 [dop-2::GFP + pha-1(+)]. |
|
| OH18501 |
C. elegans |
aex-1(ot1357) I. Show Description
ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
|
| OH18512 |
C. elegans |
pha-1(e2123) III; otEx8085. Show Description
otEx8085 [pha-4(prom2)::GFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to select for animals carrying the array. pha-4 cis-regulatory element drives expression specifically in all 20 pharyngeal enteric neurons, 2 hindgut enteric neurons, as well as RIS and PVT. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
|
| OH18559 |
C. elegans |
him-5(e1490) V; otIs810. Show Description
otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]. |
|
| OH18595 |
C. elegans |
unc-25(ot1372[unc-25::T2A::GFP::H2B] III. Show Description
Endogenous unc-25 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452. |
|
| OH18614 |
C. elegans |
hlh-13(ot1388) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
|
| OH18615 |
C. elegans |
hlh-15(ot1389) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
|
| OH18694 |
C. elegans |
col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
|
| OH18755 |
Pristionchus pacificus |
unc-30(ot5019) IV. Show Description
unc |
|
| OH18779 |
Pristionchus pacificus |
unc-25(ot5020) III. Show Description
unc |
|
| OH18835 |
C. elegans |
ins-7(ot1427) IV. Show Description
ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
|
| OH18840 |
C. elegans |
hlh-32(ot1347) IV. Show Description
CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329 |
|
| OH19034 |
C. elegans |
degt-1(ot1466) V. Show Description
Null allele. ot1466 is a CRISPR-engineered deletion removing the complete CDS. Normal growth & viability. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2 |
|
| OH19124 |
C elegans |
pks-1(ot1488[pks-1::SL2::mScarlet-I3::H2B]) X. Show Description
SL2::mScarlet-I3::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
|
| OH19125 |
C elegans |
pks-1(ot1489[pks-1::SL2::GFP::H2B]) X. Show Description
GFP::H2B tag inserted into endogenous pks-1 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
|
| OH19204 |
C elegans |
golg-4(ot1508[GFP::golg-4]) III. Show Description
GFP tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
|
| OH19205 |
C elegans |
golg-4(ot1509[mScarlet3::golg-4]) III. Show Description
mScarlet3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
|
| OH19206 |
C elegans |
golg-4(ot1510[mScarlet-I3::golg-4]) III. Show Description
mScarlet-I3 tag inserted into endogenous golg-4 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. Genetics. 2024 Oct 7;228(2):iyae126. doi: 10.1093/genetics/iyae126. PMID: 39103170. |
|
| OH19278 |
C. elegans |
aex-4(ot1530[aex-4::SL2::gfp::his-44]) X. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-4 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
|
| OH19280 |
C. elegans |
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
|
| OH19299 |
C elegans |
unc-75(ot1539[mScarlet-I3::unc-75]) I. Show Description
mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https://doi.org/10.1101/2024.06.11.598534. |
|
| OH19333 |
C. elegans |
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. Show Description
SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
|
| OH19337 |
C. elegans |
tph-1(ot1545) II. Show Description
ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693. |
|
| OH19441 |
C. elegans |
mab-23(ot1574) him-5(e1490) V. Show Description
CRIPSR/Cas9-engineered mab-23 null mutant. Him. Abnormal male tail. Generated in N2 background. crRNA1: AGTGTACTTGGTCCCAAAAG. crRNA2: CGTTTTGCTTCATTTTACAC. ssODN: ATTGGTCCACGCACTGTTCTATGGCCACGCCTCTTTAAAATGAAGCAAAACGAATCCAAGTCAACACAGA. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
|
| OH19444 |
C. elegans |
dmd-3(ot1577) him-5(e1490) V. Show Description
CRIPSR/Cas9-engineered dmd-3 null mutant. Him. Abnormal male tail. Generated in N2 background. crRNA1: ACAAGTTTTATATTGTGATA. crRNA2: AAATCAATATGGTAACGTTT. ssODN: TTTTTTTTCTGAATAAAAAAAAAATTGTACCTTATCGTTACCATATTGATTTTCTCGGTGATTTGATCAC. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
|
| OH1960 |
C. elegans |
pha-1(e2123) III; otEx1043. Show Description
otEx1043 [dop-1(prom2)::GFP + pha-1(+)]. |
|
| OH2000 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1076. Show Description
otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers. |
|
| OH20089 |
C. elegans |
otEx8333. Show Description
otEx8333 [sre-22p::GFP::H2B::tbb-2 3'UTR + unc-122p::GFP]. Maintain by picking GFP+ in coelomocytes. sre-22 promoter fragment drives expression specifically in PVT neuron. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038. |
|
| OH2024 |
C. elegans |
exc-4(rh133) I; otEx1000. Show Description
otEx1000 [hsp16-2::exc-4(cDNA)::GFP + rol-6(su1006)]. Maintain by picking Rollers. |
|
| OH20419 |
C. elegans |
zfh-2(syb10278[zfh-2::GSGGSGGTGGSG::mIAA7::wrmScarlet-I3-mIAA7]) I; otSi4 II. Show Description
otSi4 [myo-2p::TIR1(F79G)::mRuby::unc-54 3'UTR *ieSi60] II. Endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069. |
|
| OH2042 |
C. elegans |
lin-49(ot78) dpy-20(?) IV; otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain. |
|
| OH2096 |
C. elegans |
lin-23(ot1) II; oxIs12 X; otEx1131. Show Description
otEx1131[unc-47::GFP + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers. |
|
| OH2143 |
C. elegans |
otIs39 II; wrk-1(ok695) X. Show Description
otIs39 [unc-47(delta)::GFP + lin-15(+)]. |
|
| OH2204 |
C. elegans |
otEx1182. Show Description
otEx1182[gst-44p::gst-44::GFP + rol-6(dom)]. Maintain by picking Rollers. |
|
| OH2211 |
C. elegans |
otEx1184. Show Description
otEx1184 [exl-1p::exl-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Translational GFP fusion localizes to lysosomal membranes in the intestine and to the Golgi apparatus in neurons and muscle. |
|
| OH2246 |
C. elegans |
otIs107. Show Description
otIs107 [ser-2::GFP + lin-15(+)]. Not on LG X. |
|
| OH2344 |
C. elegans |
eno-2(ot2) I; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
|
| OH2345 |
C. elegans |
eno-3(ot3) oxIs12 X. Show Description
Ectopic DVB outgrowth. oxIs12 [unc-47p::GFP + lin-15(+)]. |
|
| OH2346 |
C. elegans |
eno-6(ot6) V; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
|
| OH2347 |
C. elegans |
eno-11(ot40) I; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
|
| OH2382 |
C. elegans |
eno-7(ot7) IV; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
|
| OH2383 |
C. elegans |
eno-8(ot8) III; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth. |
|
| OH2411 |
C. elegans |
pha-1(e2123) III; otEx233. Show Description
otEx233 [dop-1(prom1)::GFP + pha-1(+)]. |
|
| OH2475 |
C. elegans |
otIs157. Show Description
otIs157 [lim-6r::GFP + rol-6(su1006)]. |
|
| OH2638 |
C. elegans |
dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet. |
|
