XE3088 |
C. elegans |
pha-1(e2123) III; wpEx517. Show Description
wpEx517 [srab-20p::Neptune2.5 + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Neptune2.5 expression in PHB neuron can be used to isolate PHB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
XE3106 |
C. elegans |
pha-1(e2123) III; otIs707; wpEx525. Show Description
otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|
XM1007 |
C. elegans |
fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); unc-43(n498) IV. Show Description
Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.
|
|
XR6 |
C. elegans |
lagr-1(gk327) I; opIs219. Show Description
opIs219 contains [ced-4p::ced-4::GFP].
|
|
XT3 |
C. elegans |
cln-3.3(gk118) V. Show Description
Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
XT4 |
C. elegans |
cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
XT5 |
C. elegans |
cln-3.2(gk41) I; cln-3.1(pk479) V. Show Description
Made as model for Batten disease. Derived from XT1 and XT2. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
XT6 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) V. Show Description
Made as model for Batten disease. Derived from XT2 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
XT7 |
C. elegans |
cln-3.2(gk41) I; cln-3.3(gk118) cln-3.1(pk479) V. Show Description
Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
|
|
XW18042 |
C. elegans |
qxIs722 II. Show Description
qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.
|
|
YA1039 |
C. elegans |
mrt-1(yp2) I. Show Description
yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.
|
|
YA1116 |
C. elegans |
mrt-1(tm1354) I. Show Description
Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.
|
|
YA893 |
C. elegans |
mrt-1(e2662) I. Show Description
Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63. [NOTE: allele is incorrectly described as e2661 in this publication.]
|
|
YC256 |
C. elegans |
dcar-1(nj66) V. Show Description
Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.
|
|
YC307 |
C. elegans |
dcar-1(tm2484) V. Show Description
Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.
|
|
YEW1 |
Oscheius carolinensis |
Oscheius carolinensis. Show Description
Isolated in July 2008 in Raliegh, NC in vermicompost by Yasmin Cardoza. Isolated from Galleria mellonella (great wax moth). It can be maintained at 20C. Called Ral4a.
|
|
YL139 |
C. elegans |
meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
YL140 |
C.elegans |
meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
YL243 |
C. elegans |
unc-119(ed3) III; vrIs79. Show Description
vrIs79 [pie-1p::GFP::prg-1 + unc-119(+)]. Transgene expresses GFP::PRG-1 protein fusion. Weak GFP expression prone to silencing. Maintain stocks at 25C to retain GFP expression. Reference: Wang G, Reinke V. Curr Biol. 2008 Jun 24;18(12):861-7.
|
|
YL390 |
C. elegans |
unc-119(ed3) III; vrIs48. Show Description
vrIs48 [pie-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
YL398 |
C. elegans |
unc-119(ed3) III; vrIs55. Show Description
vrIs55 [ges-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YL402 |
C. elegans |
unc-119(ed3) III; vrIs56. Show Description
vrIs56 [pie-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YL409 |
C. elegans |
unc-119(ed3) III; vrIs60. Show Description
vrIs60 [lin-35p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YL416 |
C. elegans |
unc-119(ed3) III; vrIs64. Show Description
vrIs64 [ges-1p::hpl-2::GFP::FLAG::hpl-2 3'UTR + unc-119(+)].
|
|
YL418 |
C. elegans |
unc-119(ed3) III; vrIs65. Show Description
vrIs65 [ges-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
YL424 |
C. elegans |
unc-119(ed3) III; vrIs68. Show Description
vrIs68 [efl-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
YL425 |
C. elegans |
unc-119(ed3) III; vrIs69. Show Description
vrIs69 [dpl-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
YL445 |
C. elegans |
unc-119(ed3) III; vrIs81. Show Description
vrIs81 [pie-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
|
|
YL448 |
C. elegans |
unc-119(ed3) III; vrIs83. Show Description
vrIs83 [ges-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
|
|
YL468 |
C. elegans |
unc-119(ed3) III; vrIs93. Show Description
vrIs93 [mex-5p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
|
|
YQ95 |
C. elegans |
unc-119(ed3) III; atg-18(gk378) V; wfIs120. Show Description
wfIs120 [app-1p::atg-18::unc-54 + unc-119(+)]. Intestine-specific promoter app-1 drives atg-18 expression in the atg-18(gk378) mutant background, providing rescue in intestinal cells. Reference: Chen HD, et al. Autophagy. 2016 Nov 22:1-15.
|
|
YS2 |
C. elegans |
cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
YS4 |
C. elegans |
cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
YW16 |
C. elegans |
ced-12(tp2) I. Show Description
Persisting cell corpses. Distal tip cell migration defective.
|
|
YY11 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi. Sterile at 25 degrees. Referenced in Pavelec et al. Genetics (2009).
|
|
YY1325 |
C. elegans |
wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY1446 |
C. elegans |
znfx-1(gg634[HA::tagRFP::znfx-1]) II. Show Description
HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY1492 |
C. elegans |
mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY156 |
C. elegans |
nrde-2(gg95) II. Show Description
Reference: Guang S, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|
YY158 |
C. elegans |
nrde-3(gg66) X. Show Description
Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).
|
|
YY166 |
C. elegans |
ergo-1(gg98) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY168 |
C. elegans |
ergo-1(gg100) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY169 |
C. elegans |
ergo-1(gg102) V. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY186 |
C. elegans |
nrde-2(gg91) II. Show Description
T to A substitution at position 129 and Y to stop at position 24 in exon 2. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
|
|
YY216 |
C. elegans |
eri-9(gg106) III. Show Description
Enhanced RNAi. Isolated in lin-15B RNAi screen. Referenced in Pavelec et al. Genetics (2009).
|
|
YY238 |
C. elegans |
nrde-3(gg64) X. Show Description
Nuclear RNAi defective. Reference: Guang et al., Science 321(5888):537-41 (2009).
|
|
YY453 |
C. elegans |
nrde-4(gg129) IV. Show Description
Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
|
|
YY470 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
|
|
YY538 |
C. elegans |
hrde-1(tm1200) III. Show Description
Maintain at 15C. Heritable RNAi defective, germline mortality (Mrt) at 25C. Reference: Buckley BA, et al. Nature. 2012 Sep 20;489(7416):447-51.
|
|
YY968 |
C. elegans |
znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV. Show Description
3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|