| PS5131 |
C. elegans |
let-23(sy12)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are GFP+. mIn1 homozygotes are Dpy and GFP+. let-23(sy12) homozygotes are non-GFP.
|
|
| PS536 |
C. elegans |
unc-24(e138) let-60(sy99) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are Vul (97% Egl). Segregates dead eggs. sy99 homozygotes are lethal. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS538 |
C. elegans |
unc-24(e138) let-60(sy92) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are Vul and segregate Vul, Unc-24 lethals and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5527 |
C. elegans |
pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. Show Description
syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5551 |
C. elegans |
pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188. Show Description
syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5552 |
C. elegans |
unc-119(ed4) III; syEx974. Show Description
syEx974 [POPFOP + unc-119(+)]. Pick non-Unc and RFP+. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS5647 |
C. elegans |
unc-119(ed4) III; him-5(e1490) V; syIs202. Show Description
syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56.
|
|
| PS6187 |
C. elegans |
pha-1(e2123) unc-119(ed4) III; syEx1155. Show Description
syEx1155 [myo-3p::tomm-20::mRFP::3xMyc + Cbr-unc-119(+)]. Maintain at 15C. Pick non-Unc to maintain array.
|
|
| PS6726 |
C. elegans |
unc-119(ed4) III; syIs264. Show Description
syIs264 [col-183p::mCherry + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in the hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
|
|
| PS6843 |
C. elegans |
syIs300 V. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript]. GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6844 |
C. elegans |
syIs301 V. Show Description
syIs301
[myo-2p:NLS::GAL4SC::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6872 |
C. elegans |
syIs302 III. Show Description
syIs302 [15xUAS::?pes-10::GFP::unc-54 3'UTR + ttx-3p::RFP + pBlueScript]. GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6916 |
C. elegans |
syIs317 II. Show Description
syIs317 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript]. nlp-40 cGAL driver for intestine. NOTE: Incorrectly annotated as being on LG III in paper; actually should be on LG II. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6934 |
C. elegans |
syIs319 III. Show Description
syIs319 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] III. nlp-40 cGAL driver for the intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6935 |
C. elegans |
syIs320 V. Show Description
syIs320 [nlp-40p::NLS::GAL4SK::VP64::unc-54 3'UTR + myo-2p::NLS::mCherry + pBlueScript] V. nlp-40 cGAL driver for intestine. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6936 |
C. elegans |
syIs321 I. Show Description
syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54
3'UTR + myo-2p::NLS::mCherry + pBlueScript]. myo-3 cGAL driver for body wall muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6961 |
C. elegans |
syIs334 X. Show Description
syIs334 [rab-3p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6963 |
C. elegans |
syIs336 X. Show Description
syIs336 [rab-3p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. rab-3 cGAL driver for the whole nervous system. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS6974 |
C. elegans |
syIs337 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + pBluescript]. GFP cGAL effector. Weak background fluorescence in some head neurons and the head mesodermal cell. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7044 |
C. elegans |
syIs341 IV. Show Description
syIs341
[15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. channelrhodopsin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7045 |
C. elegans |
syIs342 II. Show Description
syIs342
[15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. channelrhodopsin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7055 |
C. elegans |
syTi1 X. Show Description
syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).
|
|
| PS7058 |
C. elegans |
syTi2 II. Show Description
syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
|
|
| PS7107 |
C. elegans |
syIs373 I. Show Description
syIs373
[15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7108 |
C. elegans |
syIs374 V. Show Description
syIs374
[15xUAS::(delta)pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7127 |
C. elegans |
unc-119(ed4) III; syIs360. Show Description
syIs360 [ets-10p::GFP + unc-119(+)]. Dauer decision marker that indicates commitment to dauer formation in neurons and intestine. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
|
|
| PS7136 |
C. elegans |
syIs378 I. Show Description
syIs378 [15xUAS::?pes-10::mKate2::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. mKate2 cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7149 |
C. elegans |
syIs390 X. Show Description
syIs390 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. GFP cGAL effector. Weak background fluorescence in some head neurons and the head mesodermal cell. [NOTE: (03/18/2020) a user has reported syIs390 does not map to LG X] Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7154 |
C. elegans |
syIs391 IV. Show Description
syIs391 [myo-2p::NLS::GAL4SK::VP64::unc-54 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. myo-2 cGAL driver for pharyngeal muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7155 |
C. elegans |
syIs392. Show Description
syIs392 [unc-17p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for Cholinergic neurons. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7160 |
C. elegans |
syIs393 IV. Show Description
syIs393 [unc-47p::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + pBlueScript]. unc-47 cGAL driver for GABAergic neurons. Relatively weak expression. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7167 |
C. elegans |
syIs396 syIs337 III. Show Description
syIs396 [unc-47p::NLS::NLS::GAL4SK::VP64::let-858
3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)].
syIs337 [15xUAS::?pes-10::GFP::let-858
3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs396 is unc-47 cGAL driver for GABAergic neurons. syIs337 is GFP cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7169 |
C. elegans |
syIs337 syIs398 III. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7171 |
C. elegans |
syIs337 III; syIs400 V. Show Description
syIs337 [15xUAS::?pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] III. syIs400 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)] V. syIs337 is a GFP cGAL effector. syIs400 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7192 |
C. elegans |
syIs413 IV. Show Description
syIs413
[15xUAS::?pes-10::ICE::let-858 3'UTR + unc-122p::GFP + pBlueScript]. Human caspase ICE cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7199 |
C. elegans |
syIs371 III. Show Description
syIs371
[15xUAS::?pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7200 |
C. elegans |
syIs420 IV. Show Description
syIs420
[15xUAS::?pes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript]. Tetanus toxin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7201 |
C. elegans |
syIs421 IV. Show Description
syIs421
[15xUAS::?pes-10::tetx::let-858 3'UTR + myo-2p::NLS::GFP + pBlueScript]. Tetanus toxin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7203 |
C. elegans |
syIs423 V. Show Description
syIs423
[15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. GCaMP6s cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7220 |
C. elegans |
flp-34(sy810) V. Show Description
flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374
|
|
| PS746 |
C. elegans |
let-23(sy97) II; sli-1(sy143) X. Show Description
sy143 suppresses sy97 viability from 15% to 100%, P12 -> P11 transformations from 27% to 14% and Vul from 100% to 3%. Do not distribute this strain; other labs should request it from the CGC.
|
|
| PS7521 |
C. elegans |
syIs483 X; syIs300. Show Description
syIs483 [unc-17p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + ceh-19p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] X. Split cGAL driver for MC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS7829 |
C. elegans |
syIs493 I. Show Description
syIs493 [sra-9p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASK neurons.
|
|
| PS7921 |
C. elegans |
unc-119(ed4) III; syEx1539. Show Description
syEx1539 [nhr-246p::GFP + unc-119(+)]. Pick non-Unc to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
|
|
| PS7973 |
C. elegans |
syIs526 III. Show Description
syIs526 [flp-24p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALA neurons.
|
|
| PS8083 |
C. elegans |
syEx1649. Show Description
syEx1649 [nhr-246p::GFP + unc-122p::RFP]. Pick RFP+ (coelomocytes) to maintain. Dauer decision marker that indicates commitment to dauer formation in intestine and hypodermis. Reference: Shih, PY, et al., Dev Biol. 2019 Jun 23. pii: S0012-1606(18)30788-7.
|
|
| PS8124 |
C. elegans |
syIs528. Show Description
syIs528 [15xUAS::kin-2(G310D dominant negative)::let-858 3'UTR + ttx-3p::GFP + 1kb DNA ladder(NEB)] cGAL effector to lower PKA activity.
|
|
| PS8131 |
C. elegans |
syIs530; syIs300 Show Description
syIs530 [ceh-63p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DVC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8132 |
C. elegans |
syIs532; syIs300 Show Description
syIs532 [hlh-34p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVH neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
| PS8278 |
C. elegans |
syIs536. Show Description
syIs536 [15xUAS::lin-3c::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] cGAL effector for epidermal growth factor
|
|
