Retarded. Animals form incomplete alae at L4 molt; most enter ectopic molt. Reference: Brenner et al. Curr Biol. 2010 Jul 27;20(14):1321-5.

Cephalobidae family. Cephalobus sp. Isolated by Susan Euling from soil near a roadway in Pontianak, Borneo, Indonesia in December 1994. Family and genus identification by Lynn Carta.

Pvul. Egl. Precocious alae. Heterochronic defects are suppressed in post-dauer stage animals. Reference: Abrahante JE, et al. Dev Cell. 2003 May;4(5):625-37.

wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine.

Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).

atrIs1 [ftt-2p::ftt-2::mCherry + unc-119(+)]. Line is slightly sick and burrows. FTT-2::mCherry fusion protein rescues ftt-2(tm1486) deletion mutant. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284. PMID: 28648843

ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50.

N-terminal GFP::TEV::degran::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635

jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.

Heterozygotes are WT and segregate WT and sterile Dpys. Referenced in Li, W. et al. J Cell Bio 187(1):33-42 (2009).

Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.

snt-1(md290) is a 3264-bp deletion removing all coding sequence in exons 3-8. Breakpoints: ttatagatttcaattaaatagtaaacaaaa / / aatctctctttgttttcactcttccaacat. Reference: Nonet ML, et al. Cell. 1993 Jul 2;73(7):1291-305.

snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, lethal. References: Rand JB. Genetics. 1989 May;122(1):73-80. Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.

Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23.

Egl. Ric. Reduced locomotion and pharyngeal pumping. Reduced body flexion at rest, but loopy backing.

Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.

mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

Slightly Lon and Unc. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.

Slightly Lon and Unc. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.

Approximately wild-type in appearance, growth, and movement. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.

Approximately wild-type for the unc-17 phenotypes; displays typical smg-1 phenotypes (protruding vulvae, defective male tails, poor male mating).

trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].

Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.

trIs30 [him-4p::MB::YFP + hmr-1b::DsRed2 + unc-129nsp::DsRed2].

trIs113 [abu-14p::abu-14::GFP + rol-6(su1006)]. Rollers. Integrated line generated from an extrachromosomal array provided by David Raizen. References: George-Raizen JB, et al. Biol Open. 2014 Oct 31;3(11):1139-49. PMID: 25361578. Kamal M, et al. bioRxiv 2022.04.11.487937; doi: https://doi.org/10.1101/2022.04.11.487937.

trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

trEx1010 [pgp-14p::sms-5B(genomic)::Flag::mCherry + pgp-14p::YFP::pgp-14]. Pick animals with mCherry+ pharynx to maintain. Fluorescence is more apparent in older animals (late stage larvae to young adults). Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.

Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.

rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous deb-1 locus tagged with mCherry. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.

unc-54(ftw19[NLS::mCherry::SL2::GFP::unc-54]) I. myo-3(ftw16[NLS::GFP::SL2::mCherry::myo-3]) V. Endogenous unc-54 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Endogenous myo-3 locus tagged with NLS::GFP and mCherry using CRISPR/Cas9; coexpressed from the endogenous promoter using trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous myo-3 locus tagged with mCherry using CRISPR/Cas9. nls-GFP coexpressed from the endogenous promoter using trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. NLS-mCherry co-expressed from the endogenous promoter using trans-splicing. Body muscles have bright green fluorescence within myofibrils and bright red nuclei visible by dissection fluorescence microscopy. Slow movement and slightly impaired egg-laying. Please contact Ryan Littlefield prior to publishing work using this strain.

GFP tag inserted into endogenous pat-3 locus; mCherry coexpressed from the endogenous pat-3 promoter via SL2 trans-splicing. mCherry tag inserted into endogenous pat-2 locus; GFP::NLS coexpressed from the endogenous pat-2 promoter via SL2 trans-splicing. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with mCherry using CRISPR/Cas9. Pharynx muscle is visibly red by dissection fluorescence microscopy. WT pumping and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. Body muscles are visibly green by dissection fluorescence microscopy except for the BWMs near the head. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

Endogenous locus tagged with GFP using CRISPR/Cas9. Pharynx muscle is visibly green by dissection fluorescence microscopy. WT movement and behavior.

ftwEx1 [mlc-2p::GFP::SL2::mCherry::mlc-2]. Pick GFP+ to maintain. Extrachromosomal array expressing GFP and mCherry in muscles. Pharynx and bodywall muscles are visibly bright green by dissection fluorescence microscopy. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.

pwIs20 contains [pie-1p::GFP::rab-5 + unc-119(+)]. Superficially wild-type. Maintain at 20 degrees.

pwIs23 [vit-2::GFP].

Yolk endocytosis defective.

pwIs50 [lmp-1::GFP + Cbr-unc-119(+)].

pwIs69 [vha-6p::GFP::rab-11 + unc-119(+)]. Likely integrated into LG X (based on user observations).

pwIs72 [vha-6p::GFP::rab-5 + Cbr-unc-119(+)]. Likely integrated in LG II.