Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
APL622 C. elegans ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
AQ3236 C. elegans ljSi2 II; unc-119(ed3) III. Show Description
ljSi2 [mec-7::GCaMP6m::SL2::TagRFP + unc-119(+)] II. GCaMP6m (13.693) and RFP expressed in touch receptor neurons (ALML/R, AVM, PVM, PLML/R). Dual expression of GCamp6m and RFP allows for ratio-metric corrections of motion artifacts. Reference: Cho Y, et al. Lab Chip. 2017 Jul 25;17(15):2609-2618.
AQ351 C. elegans bus-8A(lj22) X. Show Description
Skiddy, bleach-sensitive, drug-sensitive, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: Partridge et al. (2008) PMID: 18395708.
AQ866 C. elegans ser-4(ok512) III. Show Description
Y22D7AR.13. Hyperactive 5HT induced egglaying. Homozygous. Outer Left Sequence: AATTATCGGATTTAGGGCCG. Outer Right Sequence: ATGGAACGGAGCATTATTCG. Inner Left Sequence: CAACACGCAACGAATGTACC. Inner Right Sequence: TGTGAAGTTTGGGAGGCTTT. Inner primer WT PCR product: 3126. Outcrossed 5 times by Stanley Shyn. URL: http://www.celeganskoconsortium.omrf.org.
AR5 C. elegans hif-1(mr20) V. Show Description
Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32.
AR7 C. elegans hif-1(mr22) V. Show Description
Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32.
ARM101 C. elegans wamSi101 V; unc-119(ed3) III. Show Description
wamSi101 [eft-3p::mTFP::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mTFP from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM103 C. elegans unc-119(ed3) III; wamSi103 V. Show Description
wamSi103 [eft-3p::mKO2::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mKO2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM112 C. elegans wamSi112 II; unc-119(ed3) III Show Description
wamSi112 [eft-3p::mScarlet::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mScarlet from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM118 C. elegans wamSi118 II; unc-119(ed3) III. Show Description
wamSi118 [eft-3p::mCerulean3::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mCerulean3 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM123 C. elegans unc-119(ed3) III; wamSi123 V. Show Description
wamSi123 [eft-3p::mECitrine::unc-54 3'UTR + Cbr-unc-119 (+)] V. Expresses a single copy of mECitrine from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM3 C. elegans wamSi3 II; unc-119(ed3) III. Show Description
wamSi3 [eft-3p::mNeptune::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mNeptune from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM6 C. elegans wamSi6 II; unc-119(ed3) III. Show Description
wamSi6 [eft-3p::mTagBFP2::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagBFP2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
ARM7 C. elegans wamSi7 II; unc-119(ed3) III. Show Description
wamSi7 [eft-3p::mTagRFP-T::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagRFP-T from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
AT10 C. elegans srf-3(yj10) IV. Show Description
Superficially wild-type. Antibody staining required to observe phenotype. Contains at least one extraneous mutation in the background (Eur. Worm Mtg 2006, Venuz et al.).
AT18 C elegans srf-6(yj13) II. Show Description
No visible phenotype. Whole genome sequenced strain. Reference: Grenache DG, et al. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12388-93.
AT24 C. elegans srf-6(yj15) II. Show Description
No visible phenotype. Whole genome sequenced strain.
AT25 C elegans srf-6(yj41) II. Show Description
No visible phenotype. Whole genome sequenced strain.
AT28 C. elegans kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
AT6 C. elegans srf-2(yj262) I. Show Description
Superficially wild-type. Antibody staining required to observe phenotype.
ATD1 C. elegans unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
ATD2 C. elegans par-2(or373) unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Temperature-sensitive maternal-effect lethal. Maintain at 15C. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and EU822. Unknown if unc-119(ed3) is still present or homozygous in background. NOTE: this strain was originally described as heterozygous for lin-2(e1309), but lin-2 has been lost; this strain is now homozygous wild-type for lin-2. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
ATD3 C. elegans lon-1(e185) par-3(e2074) unc-119(ed3) III; zuIs45 V; sDp3(III;f) Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Pick wild-type to maintain. Worms carrying the sDp3 duplication are wild-type; animals that have lost the duplication are Lon Par (maternal effect lethal). Cross of JJ1473 and KK237. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
ATD6 C. elegans par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
ATD7 C. elegans par-2(ok1723)/sC1[dpy-1(s2170)], unc-119(ed3?) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Heterozygous worms are wild type and segregate wild type, Par (maternal effect lethal), and Dpy (sC1 homozygotes). Heterozygous and Par adults are indistinguishable on the plate. Maintain by picking wild-type worms and checking for correct segregation of progeny. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and VC1313. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
AU147 C. elegans daf-16(mgDf47) I; glp-1(e2141) III. Show Description
Temperature sensitive sterility. Maintain at 15C.
AU166 C. elegans daf-16(mgDf47) I; fog-2(q71) V. Show Description
Temperature sensitive. Maintain by mating males & females at 15C. fog-2(q71) is male-female.
AUM1054 C. elegans gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
AUM1695 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I. Show Description
V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1747 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1760 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz151[D583A]) I. Show Description
Inactive RNase mutation of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1787 C. elegans cosa-1(viz154[GFP::cosa-1]) III. Show Description
GFP tag inserted at N-terminus of endogenous cosa-1 locus. Expressed primarily in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1811 C. elegans plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1830 C. elegans sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AUM1863 C. elegans sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AUM1870 C. elegans ZK813.1(viz166[fln-1p::ZK813.1]) X. Show Description
The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. .
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM2023 C. elegans daf-2(e1370) unc-119(ed3) III; vizIs23. Show Description
vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40.
AUM2071 C. elegans vizSi32 II; unc-119(ed3) III. Show Description
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3’ UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
AV106 C. elegans spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny.
AV112 C. elegans mre-11(ok179) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1
AV115 C. elegans msh-5(me23) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc msh-5 homozygotes, and dead eggs (nT1 homozygotes). msh-5 homozygotes give 97.9% dead eggs; of those that hatch, 42% are male.
AV146 C. elegans chk-2(me64) rol-9(sc148)/unc-51(e369) rol-9(sc148) V. Show Description
Heterozygotes are fertile Rollers and segregate fertile non-Rollers (heterozygote), Unc Rollers (unc-51 homozygotes), and non-Unc Rollers that give 96-97% dead eggs (a high % of the survivors are males).
AV157 C. elegans spo-11(me44)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc spo-11(me44) homozygotes, and dead eggs (nT1 homozygotes). spo-11(me44) homozygotes are viable and produce more than 90% dead eggs (a large fraction of the survivors are males — strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc.
AV221 C. elegans unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
AV271 C. elegans him-3(me80)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc.
AV276 C. elegans syp-2(ok307) V/nT1 [unc-?(n754) let-?(m435)] (IV;V). Show Description
Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes.
AV307 C. elegans syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine.
AV311 C. elegans dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.
AV38 C. elegans mnDp66 (X;I); meDf2 X. Show Description
Produces 31% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf2 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf2/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf2 can be followed in heterozygotes by this weak Him phenotype.