More Fields
Strain Species Genotype
AVS411 C elegans artEx30. Show Description
artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS413 C. elegans hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AWR41 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR45 C. elegans pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR54 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR56 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR58 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR59 C. elegans keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR61 C. elegans keaSi11 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR62 C. elegans keaSi9 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR63 C. elegans keaSi12 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR64 C. elegans kea15 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AX1295 C. elegans gcy-35(ok769) I. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1296 C. elegans gcy-36(db42) X. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1297 C. elegans gcy-36(db66) X. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1305 C. elegans gcy-34(ok1012) V; npr-1(ad609) X. Show Description
Does not supress aggregation and bordering phenotypes of npr-1(null) animals.
AX1789 C. elegans dbEx719. Show Description
dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
AY131 C. elegans zcIs4 V; vit-1(ac2) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY132 C. elegans zcIs4 V; vit-2(ac3) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY133 C. elegans zcIs4 V; vit-4(ac4) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY134 C. elegans zcIs4 V; vit-5(ac5) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-5(ac5) is a dominant allele that causes ER stress. Since vit-5 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY135 C. elegans zcIs4 V; vit-6(ac6) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY157 C. elegans gon-2(q388) I; acEx157. Show Description
acEx157 [gon-2p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in intestine and gonads). gon-2 expression driven by gon-2 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY158 C. elegans gon-2(q388) I; acEx158. Show Description
acEx158 [ges-1p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in intestinal cells). gon-2 expression driven by ges-1 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY159 C. elegans gtl-2(n2618) IV; acEx159. Show Description
acEx159 [gtl-2p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in the excretory cell and pharynx). gtl-2 expression driven by gtl-2 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY160 C. elegans gtl-2(n2618) IV; acEx160. Show Description
acEx160 [sulp-4p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in the excretory cell). gtl-2 expression driven by sulp-4 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY161 C. elegans mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ?1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AY162 C. elegans mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx# transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ?1,650-bp deletion mutant of isoforms A and B (565?bp and 952?bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
AZ212 C. elegans unc-119(ed3) ruIs32 III. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous expression of GFP::H2B histone fusion in germline. pAZ132.
AZ235 C. elegans unc-119(ed3) III; ruIs48. Show Description
ruIs48 [pie-1::tubulin::GFP + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147.
AZ244 C. elegans unc-119(ed3) III; ruIs57. Show Description
ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147.
BA1013 C. elegans spe-6(hc49) vab-7(e1562)/qC1 [dpy-19(e1259) glp-1(q339)] III; spe-27(it132) IV. Show Description
Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.
BA1044 C. elegans spe-27(it132) spe-29(it127) IV; him-5(e1490) V. Show Description
Non-conditional hermaphrodite sterile. Males fertile. Self-progeny produced after mating.
BA1051 C. elegans spe-12(hc76) I; spe-29(it127) IV; him-5(e1490) V. Show Description
Self-sterile hermaphrodites; fertile males. Mated hermaphrodites produce self and outcross progeny. Self progeny are 33% males.
BA1069 C. elegans F26F4.8(hc180) III. Show Description
Deletion allele of F26F4.8. Homologous to Zn finger of Drosophila ovo transcription factor. Developmental defects in hind gut, germline and vulva. HES primers 106/107 outer and HES 108/109 inner.
BA1070 C. elegans cdh-5(hc181) IV. Show Description
Deletion allele of F08B4.2. Homologous to Drosophila fat cadherin. Primers HES 114/115 outer and HES 116/117 inner.
BA1073 C. elegans dyf-5(hc183) I. Show Description
Deletion allele of M04C9.5 (mak-kinase). No visible phenotype in hermaphrodites. Primers HES 186/187 outer and HES 188/189 inner.
BA1083 C. elegans F43G6.6(hc184) II. Show Description
Deletion allele of F43G6.6. No obvious phenotype in hermaphrodites. HES primers 162/163 outer and 164/165 inner.
BA1084 C. elegans F09C12.2(hc185) II. Show Description
Deletion allele of F09C12.2. No obvious phenotype in hermaphrodites. HES primers 122/123 outer and HES 124/125 inner.
BA1090 C. elegans cav-2(hc191) V. Show Description
No visible phenotype in hermaphrodites. Deletion allele of C56A3.7.
BA1093 C. elegans snf-10(hc194) V. Show Description
Y32F6A.2 No visible phenotype in hermaphrodites. Primers: outer HES 22/228 and inner HES 229/230.
BA14 C. elegans fer-14(hc14) X. Show Description
Temperature sensitive. 8% of total oocytes produced are fertilized and give rise to larvae at 16C. Almost completely sterile at 25C.
BA15 C. elegans rrf-3(hc15) II. Show Description
Temperature sensitive. Maintain at 15C.
BA606 C. elegans spe-6(hc49) unc-25(e156) III; eDp6 (III;f). Show Description
Animals with the Duplication are WT. Animals without the Duplication are Unc and Sterile.
BA609 C. elegans spe-6(hc49) vab-7(e1562) III; eDp6 (III;f). Show Description
Animals with the Duplications are WT. Animals which have lost the Duplication are Sterile and have an abnormal tail.
BA671 C. elegans spe-9(hc88) I. Show Description
Self-sterile at 25C. Maintain at 15C.
BA676 C. elegans spe-6(hc92) unc-32(e189) III; eDp6 (III;f). Show Description
Unc. Animals which have lost the duplications are Sterile and Unc.
BA717 C. elegans spe-11(hc90) I; sDp2 (I;f). Show Description
Animals carrying the duplication WT. Animals which have lost the Dup are sterile. Maintain by picking fertile animals and checking for segregation of fertile and sterile progeny.
BA759 C. elegans hcDf1 IV; eEx25. Show Description
eEx25 [C13G4(cosmid) + XDM23(phage)]. Animals with eEx25 are WT. Pick wild-type to maintain. Animals which have lost eEx25 are Twitchers and Sterile (occasionally produce young). This cosmid lacks the 3' end of the unc-22 gene while XDM23 lacks the 5' end of unc-22, but following injection an extrachromosomal array was formed that included at least one functional unc-22 gene.