More Fields
Strain Species Genotype
JK6403 C. elegans mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JMC101 C. elegans csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
JMC151 C. elegans csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
JMC164 C. elegans csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
JN2411 C. elegans sinh-1(pe420) II. Show Description
Chemotaxis abnormality, developmental delay, small brood size.  pe420 is a 22 bp deletion in exon 1.
JN2722 C. elegans daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
JU929 C. briggsae Cbr-dpy-18(mf104). Show Description
Mos1 insertion in CBG13195 = Cbr-dpy-18 in exon before TATgtgagtcgatttgtttgatcgg. Dpy phenotype.
KM137 C. elegans mef-2(gv2) I. Show Description
760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.
KX10 C. elegans ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
KX15 C. elegans ife-2(ok306) X. Show Description
No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).
LBV5 C. elegans str-217(ejd1) V. Show Description
DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
LC81 C. elegans cat-4(tm773) V. Show Description
Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.
LE3987 C elegans etr-1(lq61) II. Show Description
Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq61) is a premature stop in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235
LE4098 C elegans etr-1(lq133) II. Show Description
Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq133) is 2 bp deletion frameshift in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235
LSD1091 C. elegans smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LSD1097 C. elegans smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
LX1270 C. elegans rsbp-1(vs163) I. Show Description
vs163 is a 169 bp deletion removing exon 2 and causing frameshift.
LX606 C. elegans rgs-9(vs95) X. Show Description
This deletion removes most of exon1, all of exon 2, and most of exon 3. It removes a good chunk of the protein region, including the RGS domain.
LX636 C. elegans dop-1(vs101) X. Show Description
167 bp deletion which takes out most of exon 3 and the first 42 bases of exon 4. The first 22 bp of the deletion are: TATGGCTGATATCCGCAGGAAT.
LX658 C. elegans mnDp33 (X;IV)/+ IV; unc-20(e112) rgs-7(vs92) X. Show Description
Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.
MQD2884 C. elegans vit-2(ok3211) vit-1(hq532) X. Show Description
hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668
MSB486 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB609 C. elegans mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB657 C. elegans eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; lite-1 (ce314) X. Show Description
loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MT13664 C. elegans nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. Show Description
n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
MT13971 C. elegans hpl-1(n4317) X. Show Description
Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.
MT14171 C. elegans met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
MT14401 C. elegans set-12(n4442) X. Show Description
Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.
MT15884 C elegans csp-3(n4872) I. Show Description
n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
MT16973 C. elegans met-1(n4337) I. Show Description
Deletion of C43E11.3 splice donor for the 4th exon through exon 7.
NA404 C. elegans him-8(e1489) qui-1(gb404) IV. Show Description
Quinine avoidance defective. In qui-1(gb404) a CAA to TAA transition at position 11215 of Y45F10B generates a stop codon in the fifth exon of Y45F10B.10. Putative null allele.
NK2583 C. elegans unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2643 C. elegans lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NL1106 C. elegans prk-2(pk278) III. Show Description
Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).
NL1608 C. elegans dpy-20(e1282) IV; pkIs588. Show Description
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
NL2511 C. elegans msh-6(pk2504) I. Show Description
Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
NM4337 C. elegans rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
NM4431 C. elegans rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
OH11876 C. elegans pha-1(e2123) III; otIs453. Show Description
otIs453 [itr-1::GFP::utr-1a 3' UTR + pha-1(+)]. itr-1::GFP reporter contains sequence from 2282bp upstream of exon 2 of itr-1a through end of exon 3, and carrying the utr-1a 3' UTR. Reference: Kratsios P, et al. Elife. 2017 Jul 5;6. pii: e25751. doi: 10.7554/eLife.25751. PMID: 28677525
OH13098 C. elegans che-1(ot75) I. Show Description
che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
OH13333 C. elegans him-5(e1490) V; otIs514. Show Description
otIs514 [unc-25p::unc-25(partial)::GFP::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 6. Derived from injection of pMG89; line 14-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13476 C. elegans tab-1(ot796) II; otIs549 X. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13526 C. elegans him-5(e1490) V; otIs549 X. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14405 C. elegans tab-1(gk753) II; otIs549 X; otEx6747. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14548 C. elegans tab-1(gk753) II; otIs549 X; otEx6804. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14619 C. elegans elt-1(ok1002) IV; him-5(e1490) V; otIs549 X; otEx6751. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. otEx6751 [unc-47p::GFP + elt-1(+)(fosmid)]. Him. otEx6751 rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH16376 C. elegans ceh-44(ot1028) III. Show Description
ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.
OH18111 C. elegans ttx-1(syb1679[ttx-1::GFP]) ot1264) V. Show Description
ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PC71 C. elegans ubIs4. Show Description
ubIs4 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn4.
PC72 C. elegans ubIs5. Show Description
ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5.