GS9922 |
C. elegans |
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
GWJ1 |
C. elegans |
lap-1(pk486). Show Description
1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.
|
|
HBR762 |
C. elegans |
C10C6.7(goe3) IV. Show Description
goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
|
|
HBR764 |
C. elegans |
C10C6.7(goe5) IV. Show Description
goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
|
|
HX103 |
C. elegans |
chd-3(eh4) X. Show Description
T14G8.1 Deletion of 2018 bp of T14G8.1 [nucleotide 3699 (in exon 4) joined to 1682 (in exon 6)]. No phenotype observed.
|
|
IK589 |
C. elegans |
ttx-7(nj50) I. Show Description
Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.
|
|
IK591 |
C. elegans |
ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
|
|
JDW478 |
C. elegans |
cpz-1(wrd128[cpz-1::mNG::3xFLAG::linker]) I. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous cpz-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
JDW740 |
C. elegans |
acn-1(wrd285[acn-1::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the first exon of the endogenous acn-1 locus by CRISPR. Will produce a linker::mNG::3xFLAG::linker fusion after the 32nd amino acid. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
JH3180 |
C. elegans |
nos-2(ax2033) II. Show Description
Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JK6383 |
C. elegans |
mpk-1(q1147[V5::mpk-1B] q1183[mpk-1AB::2xOLLAS]) III. Show Description
Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
|
|
JK6399 |
C. elegans |
lst-1(q1198[*q867]) I. Show Description
3xV5 epitope tag inserted into endogenous lst-1 locus with a 1 bp deletion in lst-1L-specific first exon tospecifically disrupt LST-1L isoform. Synthetically sterile in combination with sygl-1(lf). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
|
|
JK6403 |
C. elegans |
mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
|
|
JMC101 |
C. elegans |
csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
|
|
JMC151 |
C. elegans |
csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
|
|
JMC164 |
C. elegans |
csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
|
|
JN2411 |
C. elegans |
sinh-1(pe420) II. Show Description
Chemotaxis abnormality, developmental delay, small brood size. pe420 is a 22 bp deletion in exon 1.
|
|
JN2722 |
C. elegans |
daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
|
|
JTL720 |
C elegans |
haps-1(ljt1) I. Show Description
CRISPR-engineered KO strain of haps-1 made by knock-in of tandem stop codons to the first exon of endogenous haps-1 locus. haps-1(C48B6.3) is the C. elegans ortholog of human HAPSTR1. haps-1(ljt1) is superficially wild-type when cultured at 20C, but is hypersensitive to paraquat (redox stress), MLN4924 (neddylation inhibition), and camptothecin (genotoxic stress). Reference: Amici DR, et al. Proc Natl Acad Sci U S A. 2022 Jul 5;119(27):e2111262119. doi: 10.1073/pnas.2111262119. PMID: 35776542.
|
|
JU929 |
C. briggsae |
Cbr-dpy-18(mf104). Show Description
Mos1 insertion in CBG13195 = Cbr-dpy-18 in exon before TATgtgagtcgatttgtttgatcgg. Dpy phenotype.
|
|
KM137 |
C. elegans |
mef-2(gv2) I. Show Description
760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.
|
|
KX10 |
C. elegans |
ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
|
|
KX15 |
C. elegans |
ife-2(ok306) X. Show Description
No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).
|
|
LBV5 |
C. elegans |
str-217(ejd1) V. Show Description
DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
|
|
LC81 |
C. elegans |
cat-4(tm773) V. Show Description
Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.
|
|
LE3987 |
C elegans |
etr-1(lq61) II. Show Description
Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq61) is a premature stop in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235
|
|
LE4098 |
C elegans |
etr-1(lq133) II. Show Description
Dpy. AQR and PQR migration defects. Body wall muscle defects. etr-1(lq133) is 2 bp deletion frameshift in alternatively-spliced exon 8. Reference: Ochs ME, et al. G3: Genes Genomes, Genetics. 2020 Jul 7;10(7):2365-2376. doi: 10.1534/g3.120.401182. PMID: 32398235
|
|
LSD1091 |
C. elegans |
smg-1(cc546) I; xchEx91. Show Description
xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
LSD1097 |
C. elegans |
smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
LX1270 |
C. elegans |
rsbp-1(vs163) I. Show Description
vs163 is a 169 bp deletion removing exon 2 and causing frameshift.
|
|
LX606 |
C. elegans |
rgs-9(vs95) X. Show Description
This deletion removes most of exon1, all of exon 2, and most of exon 3. It removes a good chunk of the protein region, including the RGS domain.
|
|
LX636 |
C. elegans |
dop-1(vs101) X. Show Description
167 bp deletion which takes out most of exon 3 and the first 42 bases of exon 4. The first 22 bp of the deletion are: TATGGCTGATATCCGCAGGAAT.
|
|
LX658 |
C. elegans |
mnDp33 (X;IV)/+ IV; unc-20(e112) rgs-7(vs92) X. Show Description
Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.
|
|
MQD2884 |
C. elegans |
vit-2(ok3211) vit-1(hq532) X. Show Description
hq532 is a CRISPR-engineered knockout of vit-1 in vit-2(ok3211) background removing 8 bp from the third exon of vit-1: WT sequence AAAGCATTGAGAAGGAGTCCACAACTGTTGTCCGCGGACGCCGTATCCAAACCGGAATCACG mutated to AAAGCATTGAGAAGGAGTCCACAAC--------GCGGACGCCGTATCCAAACCGGAATCACG. For genotyping, the following primers will produce ~800 bp DNA fragment that can be sequenced. Forward primer: TACCAACGTGTTGCTATCGTTTGCTC. Reverse primer: TTGCTCGAAGAGTGGGGTGAACATTCTC. Strain does not express vit-1 or vit-2. Reference: Zhai C, et al. bioRxiv 2022.06.27.497668; doi: https://doi.org/10.1101/2022.06.27.497668
|
|
MSB486 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
MSB609 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
MSB657 |
C. elegans |
eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; lite-1 (ce314) X. Show Description
loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
MT13664 |
C. elegans |
nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. Show Description
n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
|
|
MT13971 |
C. elegans |
hpl-1(n4317) X. Show Description
Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.
|
|
MT14171 |
C. elegans |
met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
|
|
MT14401 |
C. elegans |
set-12(n4442) X. Show Description
Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.
|
|
MT15884 |
C elegans |
csp-3(n4872) I. Show Description
n4872 is a 722 bp deletion that removes part of exon 2 and all of exons 3 and 4. Reference: Denning DP, et al. PLoS Genet. 2013;9(3):e1003341.
|
|
MT16973 |
C. elegans |
met-1(n4337) I. Show Description
Deletion of C43E11.3 splice donor for the 4th exon through exon 7.
|
|
NA404 |
C. elegans |
him-8(e1489) qui-1(gb404) IV. Show Description
Quinine avoidance defective. In qui-1(gb404) a CAA to TAA transition at position 11215 of Y45F10B generates a stop codon in the fifth exon of Y45F10B.10. Putative null allele.
|
|
NK2583 |
C. elegans |
unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
NK2643 |
C. elegans |
lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
NL1106 |
C. elegans |
prk-2(pk278) III. Show Description
Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).
|
|
NL1608 |
C. elegans |
dpy-20(e1282) IV; pkIs588. Show Description
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
NL2511 |
C. elegans |
msh-6(pk2504) I. Show Description
Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).
|
|
NM4337 |
C. elegans |
rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
|
|