Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6).

rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.

jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.

otIs453 [itr-1::GFP::utr-1a 3' UTR + pha-1(+)]. itr-1::GFP reporter contains sequence from 2282bp upstream of exon 2 of itr-1a through end of exon 3, and carrying the utr-1a 3' UTR. Reference: Kratsios P, et al. Elife. 2017 Jul 5;6. pii: e25751. doi: 10.7554/eLife.25751. PMID: 28677525

che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.

otIs514 [unc-25p::unc-25(partial)::GFP::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 6. Derived from injection of pMG89; line 14-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. otEx6751 [unc-47p::GFP + elt-1(+)(fosmid)]. Him. otEx6751 rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.

ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

syb5437 is a GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1410 is a deletion removing exon 5 from the endogenously-tagged cone-1 locus. Broad punctate expression of GFP. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1447 is a deletion removing exon 5 of the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

syb5500 is an oxGFP tag inserted at the C-terminus of the endogenous cone-1 locus by CRISPR. ot1485 is an early stop codon introduced into exon 3 of the endogenously-tagged cone-1 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1468 is an early stop codon introduced into exon 3 of the endogenously-tagged ceh-44 locus. Pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.

ubIs4 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn4.

ubIs5 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains the complete hsp16.48 and hsp16-1 gene pair of locus hsp16A with lacZ cloned in-frame into the second exon of hsp16.1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn5.

ubIs6 [hsp16.1::hsp-16A::lacZ + rol-6(su1006)]. Transgene contains a translational fusion to lacZ in which a Sau 3A fragment containing the intergenic region of a hsp16-48 and hsp16-1 gene pair of locus hsp16A was fused in-frame to lacZ to the Sau 3A site in exon of hsp16-1. The contruct contains the SV40 nuclear localization signal fused to the beginning of the lacZ coding region. Published as ubIn6.

Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]

Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]

Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

GFP tag inserted at exon 7 of the endogenous ceh-44 locus by CRISPR. Nuclear pan-neuronal nuclear and broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

T07A9.10. syb6377 deletion removes all but exon 1 and part of exon 2 of uncp-18 locus. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted in exon 4 of endogenous ceh-44 locus. Broad, weak, punctate GFP expression in non-neuronal cells. Please contact Oliver Hobert prior to publishing work using this strain.

ap426 is a CRISPR-engineered 8 bp deletion in the ALG-2 isoform A exon 2 causing a frameshift that produces a heavily truncated protein. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of kcnl-2. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. left flanking sequence: GTGATGTAAACGAAATTCCAAAAACGAATGGAGG right flanking sequence: AGGACATCCAATTGTTAGAAGAAAAAGTGGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAAAAACGAATGGAGGTCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 2nd exon of the gene. Left flanking sequence: catatattttcccgttttttgcagCTTTTCCAGCT. Right flanking sequence: ATCCATGGCTTCACAAACCGATTTCAAGGACAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTGTGAAGCCATGGATAGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop).

C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C4.9 Homozygous. Outer Left Sequence: TGATTCATCGAAGGTCACCA. Outer Right Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Left Sequence: AAGGCAGCAGAAGCAGTAGC. Inner Right Sequence: GATGGCCGTGATCTACCAGT. Inner Primer PCR Length: 3043. Estimated Deletion Size: about 500 bp. Update added 2/04: Work completed by Arseni Markoff: Deletion is 404 bp, starts at genomic position 2874 (+/- AATA) from atg (+1) of the gene and ends 3277 +/-4. Thus it begins 18 +/-4 bp from the end of exon 4 and lies entirely in intron 4 of the gene (I-4 is 927 bp). I checked if a possible branching site in the intron should be affected by this deletion, but it seems not to be the case. Our conclusion is that the deletion represents a non-functional mutation. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

unc-41(md134) is a 5.9-kb deletion that forms an in-frame splice site in the middle of an exon allowing protein production.

Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.

mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.

gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) Derived from parental strains BC1282 and SD1894.

gaIs285 [unc-62(7a)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7b of unc-62 to generate an UNC-62(7a)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP601, which wa outcrossed to produce SD1888. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

gaIs285 [unc-62(7a)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which was outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1888.

gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. glo-4(ok623) causes a a partially-penetrant Dpy phenotype. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org). Derived from parental strains RB811 and SD1894.

Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.