| QC104 |
C. elegans |
etIs2 III; mig-6(et4) V. Show Description
etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. 100% of worms have a twisted pharynx, which is easily seen as a twisted appearance of the M3 neurons. |
|
| QC142 |
C. elegans |
fld-1(et45) I; paqr-2(tm3410) mdt-15(et14) III. Show Description
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2. |
|
| QC145 |
C. elegans |
fld-1(et48) I; paqr-2(tm3410) mdt-15(et14) III. Show Description
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2. |
|
| QC146 |
C. elegans |
fld-1(et49) I; iglr-2(et34) III. Show Description
The fld-1 mutation acts as a suppressor of iglr-2 but the strain still displays weak version of the iglr-2 phenotypes including reduced growth in the presence of glucose or at 15°C, and occasionally produces a tail tip defect. |
|
| QC153 |
C. elegans |
fld-1(et46) I. Show Description
The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349 |
|