More Fields
Strain Species Genotype
DG832 C. elegans emb-30(tn475)/eT1 III; unc-46(e177) mdf-1(gk2)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-46 Steriles, and Unc-36 (eT1 homozygotes). Maintain by picking WT.
EL186 C. elegans dpy-19(e1259) ego-4(om30)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs. dpy-19 ego-4 progeny die as embryos.
EL187 C. elegans dpy-19(e1259) ego-5(om31)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs.
FX291 C. elegans +/eT1 III; spn-4(tm291)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. 1/3 of WT animals (spn-4 homozygotes) are Mels: segregate only dead embryos with have no morphogenesis. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GC613 C. elegans eef-1A.1(ar229) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Steriles (homozygous ar229), Unc-36 (homozygous eT1), and dead eggs. ar229 have severely reduced germline proliferation.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
JK1129 C. elegans unc-32(e189) qDf2/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1389 C. elegans mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK1505 C. elegans unc-32(e189) glp-1(e2072) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2533 C. elegans qC1 [dpy-19(e1259) glp-1(q339) qIs26] III/eT1 (III;V). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK590 C. elegans glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
JK633 C. elegans unc-36(e873)/unc-32(e189) glp-1(q46) III. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and UncSteriles and dead eggs. e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK892 C. elegans unc-36(e873)/unc-32(e189) glp-1(q231) III. Show Description
Heterozygotes are WT. At 25C hets segregate WT, Unc-36 and UncSterile and dead eggs. At 15C, hets segregate WT, Unc-36, dead eggs and Unc-32 (which are fertile and can be maintained as homozygous stock). e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JS71 C. elegans dpy-11(e224) air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.
JS83 C. elegans air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.
JT5132 C. elegans +/eT1 III; exp-2(sa26)/eT1 [let-?(n886)] V. Show Description
Heterozygotes have jerky movement, are Exp defective, and are Egl (dominant). Homozygous exp-2 are recessive lethal. Homozygous eT1 are lethal also.
MT10784 C. elegans dpy-18(e364) lis-1(n3334) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy.
MT12960 C. elegans epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
MT12963 C. elegans ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
MT1965 C. elegans lin-12(n941)/eT1 III; him-5(e1467)/eT1 [him-5(e1467)] V. Show Description
n941 is a lin-12 null allele. e1467 is also carried on eT1.
MT20112 C. elegans +/eT1 III; unc-46(e177) dpy-11(e224)/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20113 C. elegans unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20114 C. elegans eT1 (III;V); nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Unc.
MT2583 C. elegans dpy-11(e224) nDf32 V/eT1 (III;V). Show Description
Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.
MT2590 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
MT2591 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
MT2592 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.
MT5491 C. elegans nDf40 dpy-18(e364) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, dead eggs and zygotic embryonic lethals (nDf40 dpy-18 homozygotes). Maintain by picking WT.
MT7482 C. elegans sqv-3(n2823) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, and Sqvs which have an abnormal vulva from mid-L4 and are sterile.
MT7553 C. elegans dpy-19(e1259) sqv-3(n2842)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, DpySqv, Unc-36 and dead eggs.
MT7556 C. elegans sqv-3(n2842)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Sqv, Unc-36 and dead eggs.
NW1619 C. elegans dpy-11(e224) mig-6(ev700) V/eT1 (III;V). Show Description
Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1623 C. elegans dpy-11(e224) mig-6(ev788) V/eT1 (III;V). Show Description
Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1625 C. elegans dpy-11(e224) mig-6(e1931) V/eT1 (III;V). Show Description
Heterozygotes are wild-type and segregate WT, Dpy-Ste Unc, and dead eggs. Maintain by picking wild-type.
QC101 C. elegans mnm-1(et1) etIs2 III. Show Description
etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Egl. Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. Nearly 90% of worms have defects in the distal ends of the pharyngeal M2 neurons.
RG3225 C. elegans Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III; +/eT1 [umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
TY415 C. elegans unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. Show Description
WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.
VC109 C. elegans apc-11(gk37)/eT1 III; +/eT1 V. Show Description
F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC112 C. elegans ccf-1(gk40)/eT1 III; +/eT1 IV. Show Description
Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC173 C. elegans +/eT1 III; gck-1(gk137)/eT1 V. Show Description
T19A5.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk137 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC180 C. elegans +/eT1 III; tnt-4(gk136)/eT1 V. Show Description
T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC269 C. elegans sqv-3&vha-1(ok513)/eT1 III; +/eT1 V. Show Description
R10E11.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok513 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC301 C. elegans ant-1.1(gk172)/eT1 III; +/eT1 V. Show Description
T27E9.1. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk172 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC315 C. elegans +/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC370 C. elegans rfp-1(ok572)/eT1 III; +/eT1 V. Show Description
R05D3.4. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok572 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3895 C. elegans Y79H2A.4(gk3813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/eT1 III; +/eT1 V. Show Description
Apparent homozygous lethal or sterile deletion balanced by eT1. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAACAGTGAAAATTTGAATATGCGCG. Right flanking sequence: AATTGGAATGGAAAAGAGCTGGACGCTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC402 C. elegans +/eT1 III; cdc-25.2(ok597)/eT1 V. Show Description
F16B4.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok597 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CF4639 C. elegans glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
ET100 C. elegans H01G02.2(ok200) IV. Show Description
H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.