| OP323 |
C. elegans |
unc-119(ed3) III; wgIs323. Show Description
wgIs323 [ceh-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.
|
|
| OP324 |
C. elegans |
unc-119(ed3) III; wgEx324. Show Description
wgEx324 [C34F6.9::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP327 |
C. elegans |
unc-119(ed3) III; wgIs327. Show Description
wgIs327 [F23F12.9::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP33 |
C. elegans |
unc-119(ed3) III; wgIs33. Show Description
wgIs33 [nhr-25::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP338 |
C. elegans |
unc-119(ed3) III; wgEx338. Show Description
wgEx338 [C30G4.7::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP339 |
C. elegans |
unc-119(ed3) III; wgIs339. Show Description
wgIs339 [nhr-129::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP34 |
C. elegans |
unc-119(ed3) III; wgIs34. Show Description
wgIs34 [ama-1::TY1::EGFP::3xFLAG + unc-119(+)]. Slightly Dpy. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of ama-1 coding sequence of fosmid ID#WRM0610dA01 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP340 |
C. elegans |
unc-119(ed3) III; wgIs340. Show Description
wgIs340 [nhr-129::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering.. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP341 |
C. elegans |
unc-119(ed3) III; wgIs341. Show Description
wgIs341 [skn-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP342 |
C. elegans |
unc-119(ed3) III; wgEx342. Show Description
wgEx342 [skn-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of skn-1 coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP343 |
C. elegans |
unc-119(ed3) III; wgIs343. Show Description
wgIs343 [C01B12.2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP344 |
C. elegans |
unc-119(ed3) III; wgIs344. Show Description
wgIs344 [F49E12.6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP345 |
C. elegans |
unc-119(ed3) III; wgIs345. Show Description
wgIs345 [C16A3.4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP346 |
C. elegans |
unc-119(ed3) III; wgIs346. Show Description
wgIs346 [C30G4.7::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP347 |
C. elegans |
unc-119(ed3) III; wgIs347. Show Description
wgIs347 [hlh-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP348 |
C. elegans |
unc-119(ed3) III; wgIs348. Show Description
wgIs348 [lin-11::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP349 |
C. elegans |
unc-119(ed3) III; wgIs349. Show Description
wgIs349 [cnd-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP350 |
C. elegans |
unc-119(ed3) III; wgIs350. Show Description
wgIs350 [eor-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP356 |
C. elegans |
unc-119(ed3) III; wgIs356. Show Description
wgIs356 [nhr-25::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP37 |
C. elegans |
unc-119(ed3) III; wgIs37. Show Description
wgIs37 [pha-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of pha-4 coding sequence of fosmid ID#WRM0617dE06 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP388 |
C. elegans |
unc-119(ed3) III; wgIs388. Show Description
wgIs388 [lim-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP401 |
C. elegans |
unc-119(ed3) III; wgIs401. Show Description
wgIs401 [F47H4.1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP427 |
C. elegans |
unc-119(ed3) III; wgIs427. Show Description
wgIs427 [mbf-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP43 |
C. elegans |
unc-119(ed3) III; wgIs43. Show Description
wgIs43 [nhr-23::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP51 |
C. elegans |
unc-119(ed3) III; wgIs51. Show Description
wgIs51 [lin-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of lin-13 coding sequence of fosmid ID#WRM0628dG03 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP54 |
C. elegans |
unc-119(ed3) III; wgIs54. Show Description
wgIs54 [egl-5::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of egl-5 coding sequence of fosmid ID#WRM066cA09 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP55 |
C. elegans |
unc-119(ed3) III; wgIs55. Show Description
wgIs55 [mec-3::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP56 |
C. elegans |
unc-119(ed3) III; gaEx290. Show Description
gaEx290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP57 |
C. elegans |
unc-119(ed3) III; wgIs57. Show Description
wgIs57 [sem-4::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP62 |
C. elegans |
unc-119(ed3) III; wgIs62. Show Description
wgIs62 [lin-11::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP64 |
C. elegans |
unc-119(ed3) III; wgIs64. Show Description
wgIs64 [hlh-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP68 |
C. elegans |
unc-119(ed3) III; wgIs68. Show Description
wgIs68 [ttx-3::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP70 |
C. elegans |
unc-119(ed3) III; wgIs70. Show Description
wgIs70 [mep-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP72 |
C. elegans |
unc-119(ed3) III; wgIs72. Show Description
wgIs72 [lin-12::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP73 |
C. elegans |
unc-119(ed3) III; wgIs73. Show Description
wgIs73 [ceh-14::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP74 |
C. elegans |
unc-119(ed3) III; wgIs74. Show Description
wgIs74 [hlh-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP748 |
C. elegans |
unc-119(ed3) III; wgIs748. Show Description
wgIs748 [ceh-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP75 |
C. elegans |
unc-119(ed3) III; wgEx75. Show Description
wgEx75 [elt-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP77 |
C. elegans |
unc-119(ed3) III; wgIs77. Show Description
wgIs77 [unc-130::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP78 |
C. elegans |
unc-119(ed3) III; wgIs78. Show Description
wgIs78 [fkh-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP81 |
C. elegans |
unc-119(ed3) III; wgIs81. Show Description
wgIs81 [eor-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP83 |
C. elegans |
unc-119(ed3) III; wgIs83. Show Description
wgIs83 [zag-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP86 |
C. elegans |
unc-119(ed3) III; wgIs86. Show Description
wgIs86 [peb-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP90 |
C. elegans |
unc-119(ed3) III; wgIs90. Show Description
wgIs90 [nhr-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| OP92 |
C. elegans |
unc-119(ed3) III; wgIs92. Show Description
wgIs92 [sdc-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| OP99 |
C. elegans |
unc-119(ed3) III; wgIs99. Show Description
wgIs99 [nhr-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
|
|
| PD1594 |
C. elegans |
ccTi1594 unc-119(ed3) III. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
|
|
| PD2217 |
C. elegans |
ccTi1594 unc-119(ed3) III; hjSi20 IV. Show Description
ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
|
|
| PLG1 |
C. elegans |
src-1(ccp1[src-1::gfp]) I; unc-119(ed3) III; ltIs37 IV. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT
|
|
| PQ320 |
C. elegans |
apIs320 II; unc-119(ed3) III. Show Description
apIs320 [let-7::unc-119(+)] II. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
|
|