JK1389 |
C. elegans |
mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1505 |
C. elegans |
unc-32(e189) glp-1(e2072) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK2533 |
C. elegans |
qC1 [dpy-19(e1259) glp-1(q339) qIs26] III/eT1 (III;V). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK590 |
C. elegans |
glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
|
|
JK633 |
C. elegans |
unc-36(e873)/unc-32(e189) glp-1(q46) III. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and UncSteriles and dead eggs. e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK892 |
C. elegans |
unc-36(e873)/unc-32(e189) glp-1(q231) III. Show Description
Heterozygotes are WT. At 25C hets segregate WT, Unc-36 and UncSterile and dead eggs. At 15C, hets segregate WT, Unc-36, dead eggs and Unc-32 (which are fertile and can be maintained as homozygous stock). e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JS71 |
C. elegans |
dpy-11(e224) air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.
|
|
JS83 |
C. elegans |
air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.
|
|
JT5132 |
C. elegans |
+/eT1 III; exp-2(sa26)/eT1 [let-?(n886)] V. Show Description
Heterozygotes have jerky movement, are Exp defective, and are Egl (dominant). Homozygous exp-2 are recessive lethal. Homozygous eT1 are lethal also.
|
|
MT10784 |
C. elegans |
dpy-18(e364) lis-1(n3334) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy.
|
|
MT12960 |
C. elegans |
epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
|
|
MT12963 |
C. elegans |
ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
|
|
MT1965 |
C. elegans |
lin-12(n941)/eT1 III; him-5(e1467)/eT1 [him-5(e1467)] V. Show Description
n941 is a lin-12 null allele. e1467 is also carried on eT1.
|
|
MT20112 |
C. elegans |
+/eT1 III; unc-46(e177) dpy-11(e224)/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
|
|
MT20113 |
C. elegans |
unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
|
|
MT20114 |
C. elegans |
eT1 (III;V); nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Unc.
|
|
MT2583 |
C. elegans |
dpy-11(e224) nDf32 V/eT1 (III;V). Show Description
Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.
|
|
MT2590 |
C. elegans |
+/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
|
|
MT2591 |
C. elegans |
+/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
|
|
MT2592 |
C. elegans |
+/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.
|
|
MT5491 |
C. elegans |
nDf40 dpy-18(e364) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, dead eggs and zygotic embryonic lethals (nDf40 dpy-18 homozygotes). Maintain by picking WT.
|
|
MT7482 |
C. elegans |
sqv-3(n2823) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, and Sqvs which have an abnormal vulva from mid-L4 and are sterile.
|
|
MT7553 |
C. elegans |
dpy-19(e1259) sqv-3(n2842)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, DpySqv, Unc-36 and dead eggs.
|
|
MT7556 |
C. elegans |
sqv-3(n2842)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Sqv, Unc-36 and dead eggs.
|
|
NW1619 |
C. elegans |
dpy-11(e224) mig-6(ev700) V/eT1 (III;V). Show Description
Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
|
|
NW1623 |
C. elegans |
dpy-11(e224) mig-6(ev788) V/eT1 (III;V). Show Description
Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
|
|
NW1625 |
C. elegans |
dpy-11(e224) mig-6(e1931) V/eT1 (III;V). Show Description
Heterozygotes are wild-type and segregate WT, Dpy-Ste Unc, and dead eggs. Maintain by picking wild-type.
|
|
QC101 |
C. elegans |
mnm-1(et1) etIs2 III. Show Description
etIs1 [ric-19p::ric-19::GFP + rol-6(su1006). Egl. Low levels of ric19::GFP fusion protein expression driven by the ric-19 promoter in all neurons except for strong expression in the pharyngeal M2 neurons. Nearly 90% of worms have defects in the distal ends of the pharyngeal M2 neurons.
|
|
RG3225 |
C. elegans |
Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III; +/eT1 [umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
TY415 |
C. elegans |
unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. Show Description
WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.
|
|
VC109 |
C. elegans |
apc-11(gk37)/eT1 III; +/eT1 V. Show Description
F35G12.9. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and sterile homozygous gk37 hermaphrodites. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC112 |
C. elegans |
ccf-1(gk40)/eT1 III; +/eT1 IV. Show Description
Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC173 |
C. elegans |
+/eT1 III; gck-1(gk137)/eT1 V. Show Description
T19A5.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk137 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC180 |
C. elegans |
+/eT1 III; tnt-4(gk136)/eT1 V. Show Description
T08B1.2. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk136 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC269 |
C. elegans |
sqv-3&vha-1(ok513)/eT1 III; +/eT1 V. Show Description
R10E11.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok513 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC301 |
C. elegans |
ant-1.1(gk172)/eT1 III; +/eT1 V. Show Description
T27E9.1. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk172 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC315 |
C. elegans |
+/eT1 III; mrck-1(ok586)/eT1 V. Show Description
K08B12.5. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok586 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC370 |
C. elegans |
rfp-1(ok572)/eT1 III; +/eT1 V. Show Description
R05D3.4. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok572 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3895 |
C. elegans |
Y79H2A.4(gk3813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/eT1 III; +/eT1 V. Show Description
Apparent homozygous lethal or sterile deletion balanced by eT1. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAACAGTGAAAATTTGAATATGCGCG. Right flanking sequence: AATTGGAATGGAAAAGAGCTGGACGCTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC402 |
C. elegans |
+/eT1 III; cdc-25.2(ok597)/eT1 V. Show Description
F16B4.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok597 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
CF4639 |
C. elegans |
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
ET100 |
C. elegans |
H01G02.2(ok200) IV. Show Description
H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
|
|
ET113 |
C. elegans |
unc-119(ed3) III; ekIs2. Show Description
ekIs2 contains [pie-1p::GFP::cyb-1 + unc-119(+)]. Translational fusion of CYB-1 expressed from the pie-1 promoter and including the pie-1 3'UTR. GFP::CYB-1 expression in the proximal gonad, with staining disappearing in the zygote. Maintain at 25°C.
|
|
ET137 |
C. elegans |
C30G12.1(ok910) II. Show Description
C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/
|
|
ET182 |
C. elegans |
ekEx25. Show Description
ekEx25 [wrt-2p::CDC-6::GFP + rol-6(su1006)]. Pick Rollers to maintain the extrachromosomal array.
|
|
QC115 |
C. elegans |
atfs-1(et15) V. Show Description
Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
|
|
QC116 |
C. elegans |
atfs-1(et16) V. Show Description
Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
|
|
QC117 |
C. elegans |
atfs-1(et17) V. Show Description
Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
|
|
QC118 |
C. elegans |
atfs-1(et18) V. Show Description
Gain-of-function atfs-1 allele. Reference: Rauthan M, et al. Proc Natl Acad Sci U S A. 2013 Apr 9;110(15):5981-6.
|
|
QC123 |
C. elegans |
paqr-2(tm3410) III; cept-1(et10) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et10) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et10) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|