BC3702 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-402(s1526)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
BC3712 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-474(s1577)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
BC3713 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-473(s1602)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. [This strain is acting strangely: it is throwing bent heads. 12/95]
|
|
BC3716 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-475(s1606)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult) and dead eggs. Maintain by picking WT.
|
|
BC3718 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-407(s1631)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT.
|
|
BC3727 |
C. elegans |
dpy-18(e364)/eT1 III; sDf56 unc-46(e177)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3728 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-480(s1607)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult) and dead eggs. Maintain by picking WT.
|
|
BC3729 |
C. elegans |
dpy-18(e364)/eT1 III; let-478(s1620) let-?(s2169) unc-46(e177)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
BC3731 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-479(s1576)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult-> Lays unfertilized eggs) and dead eggs. Maintain by picking WT.
|
|
BC3732 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-418(s1617)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult; Vulva protrudes; partial rescue at 15C) and dead eggs. Maintain by picking WT.
|
|
BC3733 |
C. elegans |
dpy-18(e364)/eT1 III; let-481(s1636) unc-46(e177)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT.
|
|
BC3737 |
C. elegans |
sDp8 (III;I); eT1 (III;V). Show Description
WT strain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3953 |
C. elegans |
dpy-18(e364)/eT1 III; sDf70 unc-46(e177)/eT1 [let-500(s2165)] V. Show Description
Heterozygotes are WT and segregate WT, no Unc36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3954 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) sDf71/eT1 [let-500(s2165)] V. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Embryonic lethal. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3955 |
C. elegans |
dpy-18(e364)/eT1 III; sDf72 unc-46(e177)/eT1 [let-500(s2165)] V. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Embryonic lethal. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3956 |
C. elegans |
dpy-18(e364)/eT1 III; sDf73 unc-46(e177)/eT1 [let-500(s2165)] V. Show Description
Heterozygotes are WT and segregate WT, dead eggs, no Unc-36, and DpyUncLet. Lethal early larva. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3957 |
C. elegans |
dpy-18(e364)/eT1 III; sDf74 unc-46(e177)/eT1 [let-500(s2165)] V. Show Description
WT strain which segregates WT and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC3958 |
C. elegans |
dpy-18(e364)/eT1 III; sDf75 unc-46(e177)/eT1 [let-500(s2165)] V. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Embryonic lethal. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC4425 |
C. elegans |
dpy-18(e364)/eT1 III; sDf48 unc-46(e177)/eT1 [let-500(s2165)] V. Show Description
Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BC986 |
C. elegans |
sDp3 (III;f); eT1 (III;V). Show Description
Throws Unc-36 and WT. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BW1739 |
C. elegans |
+/eT1 III; unc-62(t2012) dpy-11(e224)/eT1 V. Show Description
Heterozygotes are wild-type, and segregate WT heterozygotes, Dpy Mel (unc-62 dpy-11 homozygotes), and dead eggs (eT1 homozygotes). unc-62 dpy-11 homozygotes give only dead embryos (96%) or dead larva (4%).
|
|
BW1747 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-427(s1057)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.
|
|
CB4281 |
C. elegans |
+/eT1 III; eDf43 dpy-11(e224)/eT1 V. Show Description
eDf43 pka lin-49(e2173). Heterozygotes are WT and segregate WT, Unc-36, and LinDpys. The lin-40 dpy-11 homozygotes are Dpy, Sterile and abnormal. Maintain by picking WT.
|
|
CB6121 |
C. elegans |
eT5 (X; III); fog-2(q71) V females and eT5 (X; III) / eT1(III; V); fog-2 / eT1 (fog-2 V; III) males Show Description
Male/female strain, propagate by crossing. Females are eT5 (III;X); fog-2(q71) V. Males are eT5 (III;X) / eT1(III;V); fog-2 / eT1 (fog-2 III;V). Strain with multichromosomal sex determination. Reference: Strain 21 in Hodgkin (2002) PMID: 12399387.
|
|
CB873 |
C. elegans |
eT1 (III;V). Show Description
M-MATING+POOR <1%WT. Recessive. Poor movement forward and backward. Unc-36 phenotype. Dead eggs.
|
|
CF4582 |
C. elegans |
muIs252 II; unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
CF4588 |
C. elegans |
muIs253 muIs252 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
|
|
CF4610 |
C. elegans |
muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
|
|
CGC19 |
C. elegans |
eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
|
|
CGC20 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
CGC23 |
C. elegans |
dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
CGC34 |
C. elegans |
eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
CGC55 |
C. elegans |
eT1 [umnIs45] III; eT1 V. Show Description
umnIs45 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
|
|
CGC60 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
CGC69 |
C. elegans |
dpy-18(e364)/eT1 [umnIs55] III; unc-46(e177)/eT1 V. Show Description
umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
|
|
CGC70 |
C.elegans |
eT1 III; eT1 [umnIs56] V. Show Description
umnIs56 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
|
|
DA1060 |
C. elegans |
+/eT1 III; adDf1059/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.
|
|
DG769 |
C. elegans |
unc-32(e189) emb-30(tn476) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
|
|
DG783 |
C. elegans |
unc-32(e189) emb-30(tn478) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
|
|
DG784 |
C. elegans |
unc-32(e189) emb-30(tn477) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 maternal effect lethals (Mel) and Unc-36.
|
|
DG786 |
C. elegans |
unc-32(e189) emb-30(tn480) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
|
|
DG800 |
C. elegans |
unc-32(e189) tnDf2 III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
|
|
DG832 |
C. elegans |
emb-30(tn475)/eT1 III; unc-46(e177) mdf-1(gk2)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-46 Steriles, and Unc-36 (eT1 homozygotes). Maintain by picking WT.
|
|
EL186 |
C. elegans |
dpy-19(e1259) ego-4(om30)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs. dpy-19 ego-4 progeny die as embryos.
|
|
EL187 |
C. elegans |
dpy-19(e1259) ego-5(om31)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs.
|
|
FX291 |
C. elegans |
+/eT1 III; spn-4(tm291)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. 1/3 of WT animals (spn-4 homozygotes) are Mels: segregate only dead embryos with have no morphogenesis. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
GC613 |
C. elegans |
eef-1A.1(ar229) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Steriles (homozygous ar229), Unc-36 (homozygous eT1), and dead eggs. ar229 have severely reduced germline proliferation.
|
|
GLW27 |
C. elegans |
muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
|
|
GLW29 |
C. elegans |
muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
|
|
JK1129 |
C. elegans |
unc-32(e189) qDf2/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|