CB998 |
C. elegans |
unc-52(e998) II. Show Description
Severe Unc. Paralyzed adults. Dystrophic body muscle.
|
|
DM1017 |
C. elegans |
unc-52(e3003e998) II; ccar-1(ra5) IV. Show Description
Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
DM1153 |
C. elegans |
ccar-1(ra14) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
|
|
DM1154 |
C. elegans |
ccar-1(ra5) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
|
|
RG3498 |
C. elegans |
ZK1240.5(ve998[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1535 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGCGCTGATATTTTGAAGCGCACAAAAACC ; Right flanking sequence: GCAAAATGGGCATACAATTCTGCCGTTGTT. ZK1240.5 sgRNA A: GAATGTGCACATAGAAAGTC; ZK1240.5 sgRNA B: CGCGAACCAACTGAGATACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|