Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
CB2110 C. elegans unc-17(e245) IV; sup-2(e997) X. Show Description
Suppressed Unc. Movement almost WT.
CB7550 C. elegans erd-2.1(e997) X. Show Description
Val186Glu. Null allele. Slightly cold-sensitive; dominant suppressor of unc-17(e245). Lethal with erd-2.2(RNAi). Also known as sup-2(e997). Reference: Mathews EA, et al. Genetics. 2021;218(4):iyab065. doi:10.1093/genetics/iyab0. PMID: 33914877.
RG3497 C. elegans ZK1010.10(ve997[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTAGATTCCACTATAGTTATCCTGGAAA ; Right flanking sequence: GATCTCGACCACTTGGTGCATCGAGTCGTC. ZK1010.10 sgRNA A: CCTAGGAATTCATGACATTg; ZK1010.10 sgRNA B: GTAGAGATGGTAGGATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.