More Fields
Strain Species Genotype
BC16377 C. elegans dpy-5(e907) I; sEx16377. Show Description
sEx16377 [rCes C47D12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16380 C. elegans dpy-5(e907) I; sEx16380. Show Description
sEx16380 [rCes D2021.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16384 C. elegans dpy-5(e907) I; sEx16384. Show Description
sEx16384 [rCes F35B3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC16434 C. elegans dpy-5(e907) I; sEx16434. Show Description
sEx16434 [rCes K11H3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC17009 C. elegans dpy-5(e907) I; sEx17009. Show Description
sEx17009 [rCesT13F2.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC17132 C. elegans dpy-5(e907) I; sEx17132. Show Description
sEx17132 [rCesC39E6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC17322 C. elegans dpy-5(e907) I; sEx17322. Show Description
sEx17322 contains [rCesZC373.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC17441 C. elegans dpy-5(e907) I; sEx17441. Show Description
sEx17441 [rCes F58E10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC17993 C. elegans dpy-5(e907) I; sEx17993. Show Description
sEx17993 contains [rCesC17E4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC20063 C. elegans dpy-5(e907) I; sEx20063. Show Description
sEx20063[rCesF44E5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
CF2892 C. elegans sEx10466. Show Description
sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2893 C. elegans sEx11128. Show Description
sEx11128 [gpd-2p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC11128 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
RG3407 C. elegans slc-17.5(ve907[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCCCCATTCTTCAGCAGTTCCAACAGTC ; Right flanking sequence: GATAGTGATAATCCGATGTGAGCTGTCATT. slc-17.5 sgRNA A: TTGTAATATGAGATCATGAG; slc-17.5 sgRNA B: ATGTATGTGCAACTCAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
WE5172 C. elegans dpy-5(e907) I; ajIs1 X. Show Description
ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.